ID: 971617623

View in Genome Browser
Species Human (GRCh38)
Location 4:28812878-28812900
Sequence CCCTCAGTAAATTAGCAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971617623_971617627 19 Left 971617623 4:28812878-28812900 CCAAGTTGCTAATTTACTGAGGG No data
Right 971617627 4:28812920-28812942 GCAAGTGATCCCATTTCCAATGG No data
971617623_971617628 20 Left 971617623 4:28812878-28812900 CCAAGTTGCTAATTTACTGAGGG No data
Right 971617628 4:28812921-28812943 CAAGTGATCCCATTTCCAATGGG No data
971617623_971617629 21 Left 971617623 4:28812878-28812900 CCAAGTTGCTAATTTACTGAGGG No data
Right 971617629 4:28812922-28812944 AAGTGATCCCATTTCCAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971617623 Original CRISPR CCCTCAGTAAATTAGCAACT TGG (reversed) Intergenic
No off target data available for this crispr