ID: 971617771

View in Genome Browser
Species Human (GRCh38)
Location 4:28814397-28814419
Sequence ATGAATATCTAGAAGCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971617769_971617771 -10 Left 971617769 4:28814384-28814406 CCTCAAGAAAAATATGAATATCT No data
Right 971617771 4:28814397-28814419 ATGAATATCTAGAAGCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971617771 Original CRISPR ATGAATATCTAGAAGCAGGC TGG Intergenic
No off target data available for this crispr