ID: 971643064

View in Genome Browser
Species Human (GRCh38)
Location 4:29160050-29160072
Sequence ATGCATAGCAGTAAGCATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971643064_971643066 12 Left 971643064 4:29160050-29160072 CCTTTATGCTTACTGCTATGCAT No data
Right 971643066 4:29160085-29160107 AAATATAATTAGATTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971643064 Original CRISPR ATGCATAGCAGTAAGCATAA AGG (reversed) Intergenic
No off target data available for this crispr