ID: 971643407

View in Genome Browser
Species Human (GRCh38)
Location 4:29164665-29164687
Sequence ATGCCGTACTGGAAGTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971643403_971643407 5 Left 971643403 4:29164637-29164659 CCAATTGGCTTGAAGCAGTCCCA No data
Right 971643407 4:29164665-29164687 ATGCCGTACTGGAAGTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971643407 Original CRISPR ATGCCGTACTGGAAGTGTGA AGG Intergenic
No off target data available for this crispr