ID: 971645407

View in Genome Browser
Species Human (GRCh38)
Location 4:29193920-29193942
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971645405_971645407 12 Left 971645405 4:29193885-29193907 CCTCTCAAAAGATTTTTGTTTTT No data
Right 971645407 4:29193920-29193942 TCGAATTTTAATAAAATTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr