ID: 971648558

View in Genome Browser
Species Human (GRCh38)
Location 4:29240131-29240153
Sequence TTCCCCTCCAGTGGAGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971648558_971648562 -5 Left 971648558 4:29240131-29240153 CCTCTCACTCCACTGGAGGGGAA No data
Right 971648562 4:29240149-29240171 GGGAAAGAAAATAGGGATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971648558 Original CRISPR TTCCCCTCCAGTGGAGTGAG AGG (reversed) Intergenic
No off target data available for this crispr