ID: 971655250

View in Genome Browser
Species Human (GRCh38)
Location 4:29336006-29336028
Sequence TTATAGAAGAAAAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971655250_971655256 2 Left 971655250 4:29336006-29336028 CCTTCCTCCTTTTTCTTCTATAA No data
Right 971655256 4:29336031-29336053 CCTTTATTTCTGGCCAGACATGG No data
971655250_971655253 -8 Left 971655250 4:29336006-29336028 CCTTCCTCCTTTTTCTTCTATAA No data
Right 971655253 4:29336021-29336043 TTCTATAAACCCTTTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971655250 Original CRISPR TTATAGAAGAAAAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr