ID: 971659161

View in Genome Browser
Species Human (GRCh38)
Location 4:29389810-29389832
Sequence CTGTGTAGCTAGAAGCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971659161_971659164 3 Left 971659161 4:29389810-29389832 CCATCTTGCTTCTAGCTACACAG No data
Right 971659164 4:29389836-29389858 GGCTGTCTTTGCTCATTCCTGGG 0: 18
1: 48
2: 157
3: 613
4: 963
971659161_971659166 9 Left 971659161 4:29389810-29389832 CCATCTTGCTTCTAGCTACACAG No data
Right 971659166 4:29389842-29389864 CTTTGCTCATTCCTGGGCTTGGG No data
971659161_971659165 8 Left 971659161 4:29389810-29389832 CCATCTTGCTTCTAGCTACACAG No data
Right 971659165 4:29389841-29389863 TCTTTGCTCATTCCTGGGCTTGG No data
971659161_971659163 2 Left 971659161 4:29389810-29389832 CCATCTTGCTTCTAGCTACACAG No data
Right 971659163 4:29389835-29389857 TGGCTGTCTTTGCTCATTCCTGG 0: 18
1: 36
2: 88
3: 183
4: 846
971659161_971659168 24 Left 971659161 4:29389810-29389832 CCATCTTGCTTCTAGCTACACAG No data
Right 971659168 4:29389857-29389879 GGCTTGGGCCAAACTAACTTTGG No data
971659161_971659169 25 Left 971659161 4:29389810-29389832 CCATCTTGCTTCTAGCTACACAG No data
Right 971659169 4:29389858-29389880 GCTTGGGCCAAACTAACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971659161 Original CRISPR CTGTGTAGCTAGAAGCAAGA TGG (reversed) Intergenic
No off target data available for this crispr