ID: 971670842

View in Genome Browser
Species Human (GRCh38)
Location 4:29555226-29555248
Sequence TTCTGTTGATTTGGGGTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971670842_971670846 -5 Left 971670842 4:29555226-29555248 CCATAAACCCCAAATCAACAGAA No data
Right 971670846 4:29555244-29555266 CAGAAAAATCCATCACAGTGTGG No data
971670842_971670849 24 Left 971670842 4:29555226-29555248 CCATAAACCCCAAATCAACAGAA No data
Right 971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG No data
971670842_971670848 16 Left 971670842 4:29555226-29555248 CCATAAACCCCAAATCAACAGAA No data
Right 971670848 4:29555265-29555287 GGTTTAATCTACTGTTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971670842 Original CRISPR TTCTGTTGATTTGGGGTTTA TGG (reversed) Intergenic
No off target data available for this crispr