ID: 971670843

View in Genome Browser
Species Human (GRCh38)
Location 4:29555233-29555255
Sequence TGGATTTTTCTGTTGATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971670843_971670849 17 Left 971670843 4:29555233-29555255 CCCCAAATCAACAGAAAAATCCA No data
Right 971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG No data
971670843_971670848 9 Left 971670843 4:29555233-29555255 CCCCAAATCAACAGAAAAATCCA No data
Right 971670848 4:29555265-29555287 GGTTTAATCTACTGTTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971670843 Original CRISPR TGGATTTTTCTGTTGATTTG GGG (reversed) Intergenic
No off target data available for this crispr