ID: 971670847

View in Genome Browser
Species Human (GRCh38)
Location 4:29555253-29555275
Sequence TAGATTAAACCACACTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971670847_971670849 -3 Left 971670847 4:29555253-29555275 CCATCACAGTGTGGTTTAATCTA No data
Right 971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971670847 Original CRISPR TAGATTAAACCACACTGTGA TGG (reversed) Intergenic
No off target data available for this crispr