ID: 971670849

View in Genome Browser
Species Human (GRCh38)
Location 4:29555273-29555295
Sequence CTACTGTTCAAGAGGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971670847_971670849 -3 Left 971670847 4:29555253-29555275 CCATCACAGTGTGGTTTAATCTA No data
Right 971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG No data
971670844_971670849 16 Left 971670844 4:29555234-29555256 CCCAAATCAACAGAAAAATCCAT No data
Right 971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG No data
971670842_971670849 24 Left 971670842 4:29555226-29555248 CCATAAACCCCAAATCAACAGAA No data
Right 971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG No data
971670845_971670849 15 Left 971670845 4:29555235-29555257 CCAAATCAACAGAAAAATCCATC No data
Right 971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG No data
971670843_971670849 17 Left 971670843 4:29555233-29555255 CCCCAAATCAACAGAAAAATCCA No data
Right 971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971670849 Original CRISPR CTACTGTTCAAGAGGAAAAA TGG Intergenic
No off target data available for this crispr