ID: 971677000

View in Genome Browser
Species Human (GRCh38)
Location 4:29644629-29644651
Sequence ATGCCCTTTCAGAAGTTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971676996_971677000 30 Left 971676996 4:29644576-29644598 CCTAACAAGCTGCAGAAAAGGCC No data
Right 971677000 4:29644629-29644651 ATGCCCTTTCAGAAGTTTAAGGG No data
971676997_971677000 9 Left 971676997 4:29644597-29644619 CCTTACTCTTTCTAAGCATAGAC No data
Right 971677000 4:29644629-29644651 ATGCCCTTTCAGAAGTTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971677000 Original CRISPR ATGCCCTTTCAGAAGTTTAA GGG Intergenic
No off target data available for this crispr