ID: 971680716

View in Genome Browser
Species Human (GRCh38)
Location 4:29696459-29696481
Sequence GTGTATATGCATAAAGTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971680714_971680716 2 Left 971680714 4:29696434-29696456 CCATATTTCTATATTAAAAATAT No data
Right 971680716 4:29696459-29696481 GTGTATATGCATAAAGTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971680716 Original CRISPR GTGTATATGCATAAAGTTAA GGG Intergenic
No off target data available for this crispr