ID: 971683358

View in Genome Browser
Species Human (GRCh38)
Location 4:29731531-29731553
Sequence GGCCAAGTTGAACATTTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971683358_971683371 27 Left 971683358 4:29731531-29731553 CCTTAGAAATGTTCAACTTGGCC No data
Right 971683371 4:29731581-29731603 AGCACTTTGGGAGGCTGAGGCGG 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
971683358_971683367 18 Left 971683358 4:29731531-29731553 CCTTAGAAATGTTCAACTTGGCC No data
Right 971683367 4:29731572-29731594 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
971683358_971683365 15 Left 971683358 4:29731531-29731553 CCTTAGAAATGTTCAACTTGGCC No data
Right 971683365 4:29731569-29731591 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
971683358_971683372 28 Left 971683358 4:29731531-29731553 CCTTAGAAATGTTCAACTTGGCC No data
Right 971683372 4:29731582-29731604 GCACTTTGGGAGGCTGAGGCGGG 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
971683358_971683369 24 Left 971683358 4:29731531-29731553 CCTTAGAAATGTTCAACTTGGCC No data
Right 971683369 4:29731578-29731600 CCCAGCACTTTGGGAGGCTGAGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
971683358_971683364 14 Left 971683358 4:29731531-29731553 CCTTAGAAATGTTCAACTTGGCC No data
Right 971683364 4:29731568-29731590 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971683358 Original CRISPR GGCCAAGTTGAACATTTCTA AGG (reversed) Intergenic
No off target data available for this crispr