ID: 971687019

View in Genome Browser
Species Human (GRCh38)
Location 4:29784007-29784029
Sequence AGGAGAATATAAAAGCTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971687019_971687024 12 Left 971687019 4:29784007-29784029 CCATAAAGCTTTTATATTCTCCT No data
Right 971687024 4:29784042-29784064 TTGTTACCAAACTCAGGTGAGGG No data
971687019_971687025 13 Left 971687019 4:29784007-29784029 CCATAAAGCTTTTATATTCTCCT No data
Right 971687025 4:29784043-29784065 TGTTACCAAACTCAGGTGAGGGG No data
971687019_971687023 11 Left 971687019 4:29784007-29784029 CCATAAAGCTTTTATATTCTCCT No data
Right 971687023 4:29784041-29784063 ATTGTTACCAAACTCAGGTGAGG No data
971687019_971687022 6 Left 971687019 4:29784007-29784029 CCATAAAGCTTTTATATTCTCCT No data
Right 971687022 4:29784036-29784058 TTTGAATTGTTACCAAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971687019 Original CRISPR AGGAGAATATAAAAGCTTTA TGG (reversed) Intergenic
No off target data available for this crispr