ID: 971687022

View in Genome Browser
Species Human (GRCh38)
Location 4:29784036-29784058
Sequence TTTGAATTGTTACCAAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971687019_971687022 6 Left 971687019 4:29784007-29784029 CCATAAAGCTTTTATATTCTCCT No data
Right 971687022 4:29784036-29784058 TTTGAATTGTTACCAAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971687022 Original CRISPR TTTGAATTGTTACCAAACTC AGG Intergenic
No off target data available for this crispr