ID: 971689320

View in Genome Browser
Species Human (GRCh38)
Location 4:29812391-29812413
Sequence TAATTATCACAGCTGGCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971689320_971689322 24 Left 971689320 4:29812391-29812413 CCTGGCGCCAGCTGTGATAATTA No data
Right 971689322 4:29812438-29812460 AACGCCTGACCATGACCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971689320 Original CRISPR TAATTATCACAGCTGGCGCC AGG (reversed) Intergenic
No off target data available for this crispr