ID: 971691050

View in Genome Browser
Species Human (GRCh38)
Location 4:29836645-29836667
Sequence CCAAGATAACTACTGTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971691047_971691050 24 Left 971691047 4:29836598-29836620 CCTGACTGTGAACTGAGAACTCA No data
Right 971691050 4:29836645-29836667 CCAAGATAACTACTGTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971691050 Original CRISPR CCAAGATAACTACTGTTGCC TGG Intergenic
No off target data available for this crispr