ID: 971692036

View in Genome Browser
Species Human (GRCh38)
Location 4:29849306-29849328
Sequence TTTCTATTTGCCCCAATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971692035_971692036 -6 Left 971692035 4:29849289-29849311 CCTTACTTCACATTGAATTTCTA No data
Right 971692036 4:29849306-29849328 TTTCTATTTGCCCCAATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971692036 Original CRISPR TTTCTATTTGCCCCAATCCC TGG Intergenic
No off target data available for this crispr