ID: 971699632

View in Genome Browser
Species Human (GRCh38)
Location 4:29953937-29953959
Sequence CAGAGCTATTGCTCAAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971699631_971699632 -2 Left 971699631 4:29953916-29953938 CCGAGTTCTTATAGTGACTGGCA No data
Right 971699632 4:29953937-29953959 CAGAGCTATTGCTCAAAAATTGG No data
971699628_971699632 30 Left 971699628 4:29953884-29953906 CCATGAGGGCAGGAAAATATTTG No data
Right 971699632 4:29953937-29953959 CAGAGCTATTGCTCAAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971699632 Original CRISPR CAGAGCTATTGCTCAAAAAT TGG Intergenic
No off target data available for this crispr