ID: 971704392

View in Genome Browser
Species Human (GRCh38)
Location 4:30020866-30020888
Sequence CAGTAGTCATAGTCTACACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971704391_971704392 -5 Left 971704391 4:30020848-30020870 CCTCATCACATAAAGCAACAGTA No data
Right 971704392 4:30020866-30020888 CAGTAGTCATAGTCTACACTAGG No data
971704388_971704392 10 Left 971704388 4:30020833-30020855 CCCCATAATGTAATGCCTCATCA No data
Right 971704392 4:30020866-30020888 CAGTAGTCATAGTCTACACTAGG No data
971704390_971704392 8 Left 971704390 4:30020835-30020857 CCATAATGTAATGCCTCATCACA No data
Right 971704392 4:30020866-30020888 CAGTAGTCATAGTCTACACTAGG No data
971704389_971704392 9 Left 971704389 4:30020834-30020856 CCCATAATGTAATGCCTCATCAC No data
Right 971704392 4:30020866-30020888 CAGTAGTCATAGTCTACACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971704392 Original CRISPR CAGTAGTCATAGTCTACACT AGG Intergenic
No off target data available for this crispr