ID: 971708616

View in Genome Browser
Species Human (GRCh38)
Location 4:30081772-30081794
Sequence CACTTGGCACACTTTGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971708616_971708619 11 Left 971708616 4:30081772-30081794 CCAATATCAAAGTGTGCCAAGTG No data
Right 971708619 4:30081806-30081828 TAAATAGCTAGAACTATCGTAGG No data
971708616_971708621 23 Left 971708616 4:30081772-30081794 CCAATATCAAAGTGTGCCAAGTG No data
Right 971708621 4:30081818-30081840 ACTATCGTAGGGTGCATCTATGG No data
971708616_971708620 12 Left 971708616 4:30081772-30081794 CCAATATCAAAGTGTGCCAAGTG No data
Right 971708620 4:30081807-30081829 AAATAGCTAGAACTATCGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971708616 Original CRISPR CACTTGGCACACTTTGATAT TGG (reversed) Intergenic
No off target data available for this crispr