ID: 971715135

View in Genome Browser
Species Human (GRCh38)
Location 4:30166356-30166378
Sequence TACTGAGAGCAGGCCGGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971715131_971715135 0 Left 971715131 4:30166333-30166355 CCTTGAAATAGAAGGTTTAAAAA No data
Right 971715135 4:30166356-30166378 TACTGAGAGCAGGCCGGGCGTGG No data
971715129_971715135 15 Left 971715129 4:30166318-30166340 CCTTCACTTACTAATCCTTGAAA No data
Right 971715135 4:30166356-30166378 TACTGAGAGCAGGCCGGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971715135 Original CRISPR TACTGAGAGCAGGCCGGGCG TGG Intergenic
No off target data available for this crispr