ID: 971715722

View in Genome Browser
Species Human (GRCh38)
Location 4:30173856-30173878
Sequence TTGATCATGAATAAATCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971715722_971715724 2 Left 971715722 4:30173856-30173878 CCAGATGATTTATTCATGATCAA No data
Right 971715724 4:30173881-30173903 TAATTTACCTTATTTCAGCTGGG No data
971715722_971715723 1 Left 971715722 4:30173856-30173878 CCAGATGATTTATTCATGATCAA No data
Right 971715723 4:30173880-30173902 ATAATTTACCTTATTTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971715722 Original CRISPR TTGATCATGAATAAATCATC TGG (reversed) Intergenic
No off target data available for this crispr