ID: 971716042

View in Genome Browser
Species Human (GRCh38)
Location 4:30178693-30178715
Sequence TACCCAATCTCATGTATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971716042_971716044 28 Left 971716042 4:30178693-30178715 CCAGAAATACATGAGATTGGGTA No data
Right 971716044 4:30178744-30178766 TCATAGTTCCACAGTTATACAGG No data
971716042_971716043 4 Left 971716042 4:30178693-30178715 CCAGAAATACATGAGATTGGGTA No data
Right 971716043 4:30178720-30178742 ACAAAGAAAATAGCTTTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971716042 Original CRISPR TACCCAATCTCATGTATTTC TGG (reversed) Intergenic
No off target data available for this crispr