ID: 971717011

View in Genome Browser
Species Human (GRCh38)
Location 4:30191012-30191034
Sequence TACCTAACTGTTTTACCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971717011_971717013 -10 Left 971717011 4:30191012-30191034 CCACCTGGTAAAACAGTTAGGTA No data
Right 971717013 4:30191025-30191047 CAGTTAGGTAGTTCCTCAAAAGG No data
971717011_971717014 1 Left 971717011 4:30191012-30191034 CCACCTGGTAAAACAGTTAGGTA No data
Right 971717014 4:30191036-30191058 TTCCTCAAAAGGTTAAATGTAGG No data
971717011_971717015 2 Left 971717011 4:30191012-30191034 CCACCTGGTAAAACAGTTAGGTA No data
Right 971717015 4:30191037-30191059 TCCTCAAAAGGTTAAATGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971717011 Original CRISPR TACCTAACTGTTTTACCAGG TGG (reversed) Intergenic
No off target data available for this crispr