ID: 971717012

View in Genome Browser
Species Human (GRCh38)
Location 4:30191015-30191037
Sequence AACTACCTAACTGTTTTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971717012_971717015 -1 Left 971717012 4:30191015-30191037 CCTGGTAAAACAGTTAGGTAGTT No data
Right 971717015 4:30191037-30191059 TCCTCAAAAGGTTAAATGTAGGG No data
971717012_971717014 -2 Left 971717012 4:30191015-30191037 CCTGGTAAAACAGTTAGGTAGTT No data
Right 971717014 4:30191036-30191058 TTCCTCAAAAGGTTAAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971717012 Original CRISPR AACTACCTAACTGTTTTACC AGG (reversed) Intergenic
No off target data available for this crispr