ID: 971717015

View in Genome Browser
Species Human (GRCh38)
Location 4:30191037-30191059
Sequence TCCTCAAAAGGTTAAATGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971717012_971717015 -1 Left 971717012 4:30191015-30191037 CCTGGTAAAACAGTTAGGTAGTT No data
Right 971717015 4:30191037-30191059 TCCTCAAAAGGTTAAATGTAGGG No data
971717011_971717015 2 Left 971717011 4:30191012-30191034 CCACCTGGTAAAACAGTTAGGTA No data
Right 971717015 4:30191037-30191059 TCCTCAAAAGGTTAAATGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971717015 Original CRISPR TCCTCAAAAGGTTAAATGTA GGG Intergenic
No off target data available for this crispr