ID: 971720653

View in Genome Browser
Species Human (GRCh38)
Location 4:30241184-30241206
Sequence ACTAGCTAACCAAATGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971720653_971720654 13 Left 971720653 4:30241184-30241206 CCAACAGCATTTGGTTAGCTAGT No data
Right 971720654 4:30241220-30241242 TTTCTGCATCTATGATCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971720653 Original CRISPR ACTAGCTAACCAAATGCTGT TGG (reversed) Intergenic
No off target data available for this crispr