ID: 971721920

View in Genome Browser
Species Human (GRCh38)
Location 4:30255917-30255939
Sequence CTGGTGCTAGTACTTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971721920_971721926 -4 Left 971721920 4:30255917-30255939 CCAGACACAAGTACTAGCACCAG No data
Right 971721926 4:30255936-30255958 CCAGCTCTGATGGGGATGGCAGG No data
971721920_971721924 -8 Left 971721920 4:30255917-30255939 CCAGACACAAGTACTAGCACCAG No data
Right 971721924 4:30255932-30255954 AGCACCAGCTCTGATGGGGATGG No data
971721920_971721930 0 Left 971721920 4:30255917-30255939 CCAGACACAAGTACTAGCACCAG No data
Right 971721930 4:30255940-30255962 CTCTGATGGGGATGGCAGGGGGG No data
971721920_971721928 -2 Left 971721920 4:30255917-30255939 CCAGACACAAGTACTAGCACCAG No data
Right 971721928 4:30255938-30255960 AGCTCTGATGGGGATGGCAGGGG No data
971721920_971721929 -1 Left 971721920 4:30255917-30255939 CCAGACACAAGTACTAGCACCAG No data
Right 971721929 4:30255939-30255961 GCTCTGATGGGGATGGCAGGGGG No data
971721920_971721927 -3 Left 971721920 4:30255917-30255939 CCAGACACAAGTACTAGCACCAG No data
Right 971721927 4:30255937-30255959 CAGCTCTGATGGGGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971721920 Original CRISPR CTGGTGCTAGTACTTGTGTC TGG (reversed) Intergenic
No off target data available for this crispr