ID: 971721926

View in Genome Browser
Species Human (GRCh38)
Location 4:30255936-30255958
Sequence CCAGCTCTGATGGGGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971721918_971721926 7 Left 971721918 4:30255906-30255928 CCTCAAGTCTCCCAGACACAAGT No data
Right 971721926 4:30255936-30255958 CCAGCTCTGATGGGGATGGCAGG No data
971721920_971721926 -4 Left 971721920 4:30255917-30255939 CCAGACACAAGTACTAGCACCAG No data
Right 971721926 4:30255936-30255958 CCAGCTCTGATGGGGATGGCAGG No data
971721917_971721926 24 Left 971721917 4:30255889-30255911 CCAGTGATGTGACTTGTCCTCAA No data
Right 971721926 4:30255936-30255958 CCAGCTCTGATGGGGATGGCAGG No data
971721919_971721926 -3 Left 971721919 4:30255916-30255938 CCCAGACACAAGTACTAGCACCA No data
Right 971721926 4:30255936-30255958 CCAGCTCTGATGGGGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971721926 Original CRISPR CCAGCTCTGATGGGGATGGC AGG Intergenic
No off target data available for this crispr