ID: 971721930

View in Genome Browser
Species Human (GRCh38)
Location 4:30255940-30255962
Sequence CTCTGATGGGGATGGCAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971721917_971721930 28 Left 971721917 4:30255889-30255911 CCAGTGATGTGACTTGTCCTCAA No data
Right 971721930 4:30255940-30255962 CTCTGATGGGGATGGCAGGGGGG No data
971721918_971721930 11 Left 971721918 4:30255906-30255928 CCTCAAGTCTCCCAGACACAAGT No data
Right 971721930 4:30255940-30255962 CTCTGATGGGGATGGCAGGGGGG No data
971721920_971721930 0 Left 971721920 4:30255917-30255939 CCAGACACAAGTACTAGCACCAG No data
Right 971721930 4:30255940-30255962 CTCTGATGGGGATGGCAGGGGGG No data
971721919_971721930 1 Left 971721919 4:30255916-30255938 CCCAGACACAAGTACTAGCACCA No data
Right 971721930 4:30255940-30255962 CTCTGATGGGGATGGCAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971721930 Original CRISPR CTCTGATGGGGATGGCAGGG GGG Intergenic
No off target data available for this crispr