ID: 971723827

View in Genome Browser
Species Human (GRCh38)
Location 4:30282551-30282573
Sequence AGAGACATGATGAAGATGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971723827_971723829 22 Left 971723827 4:30282551-30282573 CCCTTCATCTTCATCATGTCTCT No data
Right 971723829 4:30282596-30282618 AAGTGTCCCACTAACTATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971723827 Original CRISPR AGAGACATGATGAAGATGAA GGG (reversed) Intergenic
No off target data available for this crispr