ID: 971732655

View in Genome Browser
Species Human (GRCh38)
Location 4:30406246-30406268
Sequence CCCTGTATTGGGGTTTCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971732655_971732663 19 Left 971732655 4:30406246-30406268 CCAAGAGAAACCCCAATACAGGG No data
Right 971732663 4:30406288-30406310 GTGAGCTTCATTCTCACTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971732655 Original CRISPR CCCTGTATTGGGGTTTCTCT TGG (reversed) Intergenic