ID: 971733311

View in Genome Browser
Species Human (GRCh38)
Location 4:30414338-30414360
Sequence ATGAAGAAATTGTAAGATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971733307_971733311 23 Left 971733307 4:30414292-30414314 CCCTACAGAGAATGCTTCAGGCT No data
Right 971733311 4:30414338-30414360 ATGAAGAAATTGTAAGATTAGGG No data
971733308_971733311 22 Left 971733308 4:30414293-30414315 CCTACAGAGAATGCTTCAGGCTG No data
Right 971733311 4:30414338-30414360 ATGAAGAAATTGTAAGATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971733311 Original CRISPR ATGAAGAAATTGTAAGATTA GGG Intergenic
No off target data available for this crispr