ID: 971733514

View in Genome Browser
Species Human (GRCh38)
Location 4:30416763-30416785
Sequence GTGTACAATAGGGGGACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971733514_971733520 -8 Left 971733514 4:30416763-30416785 CCCAGGGTCCCCCTATTGTACAC No data
Right 971733520 4:30416778-30416800 TTGTACACAGCCTAGAGACTTGG No data
971733514_971733525 30 Left 971733514 4:30416763-30416785 CCCAGGGTCCCCCTATTGTACAC No data
Right 971733525 4:30416816-30416838 CCACTCCAGCCATGATTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971733514 Original CRISPR GTGTACAATAGGGGGACCCT GGG (reversed) Intergenic
No off target data available for this crispr