ID: 971735134

View in Genome Browser
Species Human (GRCh38)
Location 4:30439504-30439526
Sequence TGATTTCTATTTCTGTCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971735134_971735139 0 Left 971735134 4:30439504-30439526 CCCTAAGACAGAAATAGAAATCA No data
Right 971735139 4:30439527-30439549 GCAGAAGATTGGTGGTGGAGTGG No data
971735134_971735137 -8 Left 971735134 4:30439504-30439526 CCCTAAGACAGAAATAGAAATCA No data
Right 971735137 4:30439519-30439541 AGAAATCAGCAGAAGATTGGTGG No data
971735134_971735140 3 Left 971735134 4:30439504-30439526 CCCTAAGACAGAAATAGAAATCA No data
Right 971735140 4:30439530-30439552 GAAGATTGGTGGTGGAGTGGAGG No data
971735134_971735138 -5 Left 971735134 4:30439504-30439526 CCCTAAGACAGAAATAGAAATCA No data
Right 971735138 4:30439522-30439544 AATCAGCAGAAGATTGGTGGTGG No data
971735134_971735141 22 Left 971735134 4:30439504-30439526 CCCTAAGACAGAAATAGAAATCA No data
Right 971735141 4:30439549-30439571 GAGGTGAATTCTCAAATGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971735134 Original CRISPR TGATTTCTATTTCTGTCTTA GGG (reversed) Intergenic
No off target data available for this crispr