ID: 971735135

View in Genome Browser
Species Human (GRCh38)
Location 4:30439505-30439527
Sequence CTGATTTCTATTTCTGTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971735135_971735139 -1 Left 971735135 4:30439505-30439527 CCTAAGACAGAAATAGAAATCAG No data
Right 971735139 4:30439527-30439549 GCAGAAGATTGGTGGTGGAGTGG No data
971735135_971735138 -6 Left 971735135 4:30439505-30439527 CCTAAGACAGAAATAGAAATCAG No data
Right 971735138 4:30439522-30439544 AATCAGCAGAAGATTGGTGGTGG No data
971735135_971735141 21 Left 971735135 4:30439505-30439527 CCTAAGACAGAAATAGAAATCAG No data
Right 971735141 4:30439549-30439571 GAGGTGAATTCTCAAATGATAGG No data
971735135_971735137 -9 Left 971735135 4:30439505-30439527 CCTAAGACAGAAATAGAAATCAG No data
Right 971735137 4:30439519-30439541 AGAAATCAGCAGAAGATTGGTGG No data
971735135_971735140 2 Left 971735135 4:30439505-30439527 CCTAAGACAGAAATAGAAATCAG No data
Right 971735140 4:30439530-30439552 GAAGATTGGTGGTGGAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971735135 Original CRISPR CTGATTTCTATTTCTGTCTT AGG (reversed) Intergenic
No off target data available for this crispr