ID: 971735141

View in Genome Browser
Species Human (GRCh38)
Location 4:30439549-30439571
Sequence GAGGTGAATTCTCAAATGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971735134_971735141 22 Left 971735134 4:30439504-30439526 CCCTAAGACAGAAATAGAAATCA No data
Right 971735141 4:30439549-30439571 GAGGTGAATTCTCAAATGATAGG No data
971735135_971735141 21 Left 971735135 4:30439505-30439527 CCTAAGACAGAAATAGAAATCAG No data
Right 971735141 4:30439549-30439571 GAGGTGAATTCTCAAATGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971735141 Original CRISPR GAGGTGAATTCTCAAATGAT AGG Intergenic
No off target data available for this crispr