ID: 971737760

View in Genome Browser
Species Human (GRCh38)
Location 4:30478763-30478785
Sequence TTTTGGCTCAATTACAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971737760_971737766 -6 Left 971737760 4:30478763-30478785 CCACCATTGTAATTGAGCCAAAA No data
Right 971737766 4:30478780-30478802 CCAAAAAAATTGTATGTTGGGGG No data
971737760_971737763 -8 Left 971737760 4:30478763-30478785 CCACCATTGTAATTGAGCCAAAA No data
Right 971737763 4:30478778-30478800 AGCCAAAAAAATTGTATGTTGGG No data
971737760_971737764 -7 Left 971737760 4:30478763-30478785 CCACCATTGTAATTGAGCCAAAA No data
Right 971737764 4:30478779-30478801 GCCAAAAAAATTGTATGTTGGGG No data
971737760_971737768 5 Left 971737760 4:30478763-30478785 CCACCATTGTAATTGAGCCAAAA No data
Right 971737768 4:30478791-30478813 GTATGTTGGGGGAGAGAAGGAGG No data
971737760_971737762 -9 Left 971737760 4:30478763-30478785 CCACCATTGTAATTGAGCCAAAA No data
Right 971737762 4:30478777-30478799 GAGCCAAAAAAATTGTATGTTGG No data
971737760_971737767 2 Left 971737760 4:30478763-30478785 CCACCATTGTAATTGAGCCAAAA No data
Right 971737767 4:30478788-30478810 ATTGTATGTTGGGGGAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971737760 Original CRISPR TTTTGGCTCAATTACAATGG TGG (reversed) Intergenic
No off target data available for this crispr