ID: 971737767

View in Genome Browser
Species Human (GRCh38)
Location 4:30478788-30478810
Sequence ATTGTATGTTGGGGGAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971737761_971737767 -1 Left 971737761 4:30478766-30478788 CCATTGTAATTGAGCCAAAAAAA No data
Right 971737767 4:30478788-30478810 ATTGTATGTTGGGGGAGAGAAGG No data
971737760_971737767 2 Left 971737760 4:30478763-30478785 CCACCATTGTAATTGAGCCAAAA No data
Right 971737767 4:30478788-30478810 ATTGTATGTTGGGGGAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971737767 Original CRISPR ATTGTATGTTGGGGGAGAGA AGG Intergenic
No off target data available for this crispr