ID: 971748925

View in Genome Browser
Species Human (GRCh38)
Location 4:30621295-30621317
Sequence CTGGAGCTAGGTGGCTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971748925_971748931 7 Left 971748925 4:30621295-30621317 CCCTCAAAGCCACCTAGCTCCAG No data
Right 971748931 4:30621325-30621347 TAATAAAATATTATTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971748925 Original CRISPR CTGGAGCTAGGTGGCTTTGA GGG (reversed) Intergenic
No off target data available for this crispr