ID: 971748987

View in Genome Browser
Species Human (GRCh38)
Location 4:30622052-30622074
Sequence CAGCATGAACAAAGGGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971748987_971748993 7 Left 971748987 4:30622052-30622074 CCCACAGCCCTTTGTTCATGCTG No data
Right 971748993 4:30622082-30622104 AACCTGAAGCAAACTTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971748987 Original CRISPR CAGCATGAACAAAGGGCTGT GGG (reversed) Intergenic
No off target data available for this crispr