ID: 971753636

View in Genome Browser
Species Human (GRCh38)
Location 4:30681191-30681213
Sequence CTGTGGGGCTGGGGGTTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971753636_971753652 24 Left 971753636 4:30681191-30681213 CCCCCTAACCCCCAGCCCCACAG No data
Right 971753652 4:30681238-30681260 TTCCCGCTGGCATTTTGCCAGGG No data
971753636_971753649 11 Left 971753636 4:30681191-30681213 CCCCCTAACCCCCAGCCCCACAG No data
Right 971753649 4:30681225-30681247 ACTGCCTTTGCTTTTCCCGCTGG No data
971753636_971753651 23 Left 971753636 4:30681191-30681213 CCCCCTAACCCCCAGCCCCACAG No data
Right 971753651 4:30681237-30681259 TTTCCCGCTGGCATTTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971753636 Original CRISPR CTGTGGGGCTGGGGGTTAGG GGG (reversed) Intergenic
No off target data available for this crispr