ID: 971758283

View in Genome Browser
Species Human (GRCh38)
Location 4:30730854-30730876
Sequence CTGGAGCCTGCCCTTGGCCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971758278_971758283 -3 Left 971758278 4:30730834-30730856 CCTTTCTACTCCGAAACCTGCTG 0: 1
1: 0
2: 0
3: 9
4: 113
Right 971758283 4:30730854-30730876 CTGGAGCCTGCCCTTGGCCGTGG 0: 1
1: 0
2: 0
3: 33
4: 268
971758277_971758283 11 Left 971758277 4:30730820-30730842 CCATACTGTGATGACCTTTCTAC 0: 1
1: 0
2: 1
3: 4
4: 101
Right 971758283 4:30730854-30730876 CTGGAGCCTGCCCTTGGCCGTGG 0: 1
1: 0
2: 0
3: 33
4: 268
971758276_971758283 21 Left 971758276 4:30730810-30730832 CCATTATGCACCATACTGTGATG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 971758283 4:30730854-30730876 CTGGAGCCTGCCCTTGGCCGTGG 0: 1
1: 0
2: 0
3: 33
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971758283 Original CRISPR CTGGAGCCTGCCCTTGGCCG TGG Exonic
900290081 1:1920070-1920092 CTGGAGCCTGGCCCTGGCTCTGG + Intergenic
900408671 1:2503323-2503345 CTGGAGCCTGCCCTAGAGGGAGG - Intronic
901212875 1:7536417-7536439 CTGCAGCCTGCCCTTTGCTGTGG + Intronic
901332576 1:8422968-8422990 CTGGGGCCTGCCCTGGCCAGTGG - Intronic
901456546 1:9366297-9366319 CTGGGGCCTGAGCTTGGCCTGGG + Intronic
901617829 1:10555955-10555977 CTGGAGCATGTCCTTGGCGCAGG + Intronic
901808997 1:11755225-11755247 CTGGAGCCTGGCTTTGGGCTGGG + Intergenic
902533693 1:17106731-17106753 TAGAAGCCTGCCCTTGGCCAGGG - Intronic
903183627 1:21617718-21617740 CTGGAGCATGACCTTGGCCCAGG + Intronic
903293214 1:22327628-22327650 CTGGAGCCTGCCTGTGGCCAGGG - Intergenic
903550285 1:24153261-24153283 CTGGCTCCTGCCCCTGGCAGTGG + Intergenic
904534239 1:31188568-31188590 CTGGAGCTTGCCCTGGCCCATGG + Intronic
905630320 1:39514817-39514839 CTAGAGCCTGCGCCTGGCCGGGG + Intronic
905667440 1:39771372-39771394 CTAGAGCCTGCGCCTGGCCGGGG - Intronic
906961827 1:50423506-50423528 GTGGCGCCTGCCATTGGCCAGGG + Intergenic
907457840 1:54586862-54586884 CTGCAGCCTGTCCTGGGCTGAGG - Intronic
907861731 1:58360223-58360245 TTGCAGCCTTCCCTTGGCCCAGG - Intronic
908169089 1:61487223-61487245 CTGGGGCCTGCCCCTGGGCCTGG - Intergenic
909093188 1:71253048-71253070 CTGGAGTCTTCCCTGGGCTGAGG + Intergenic
912385969 1:109271317-109271339 CTGGTGCCTGCCCATGGCCCAGG - Intronic
913068641 1:115280308-115280330 CTGGAGGCTGCACTTAGCTGTGG + Intergenic
913539808 1:119807842-119807864 CTGGGGAATGCCCTTGGCCAAGG - Intronic
915005442 1:152630680-152630702 CTGGGGCCTGCCCTGGGCTGGGG + Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
922668624 1:227492661-227492683 CTTGAGGCTGCCCTGGGCCTTGG - Intergenic
922718961 1:227890677-227890699 CTGGAGCCTCCCCCTGGCTGGGG - Intergenic
922865081 1:228852737-228852759 CTGGAGCATTCCCTTGGCTGGGG + Intergenic
924732484 1:246724533-246724555 CTCCCGCCTGCCCTGGGCCGTGG + Exonic
1063075399 10:2711439-2711461 CTGGAGCCTGCCCAAGGCCCTGG + Intergenic
1063094945 10:2900763-2900785 ATGCAGCCTGCCCTGGGCCAAGG + Intergenic
1063455306 10:6178613-6178635 TCGGTGCCTGCCCTGGGCCGTGG + Intronic
1063460517 10:6212461-6212483 GTGGAGCCGGCCCCTGGCTGAGG + Intronic
1065328070 10:24568173-24568195 CTGCAGCCTTCTCTTGGCCTGGG + Intergenic
1066235012 10:33477097-33477119 CTGGTGTCTGCCATTGGCCACGG - Intergenic
1067341481 10:45408728-45408750 ATGGACCCTCCCCTTGGCCAAGG - Intronic
1067568893 10:47357384-47357406 CTGGAGCATCTCCTTGGCCCTGG - Exonic
1068664399 10:59657846-59657868 ATGGACCCTCCCCTTGGCCAAGG + Intronic
1069422758 10:68261475-68261497 CTGAAGCCTGTCCTTGGGCCAGG + Intergenic
1069572251 10:69501333-69501355 GAGGAGCCTTCCCCTGGCCGGGG + Intronic
1069955006 10:72044615-72044637 CTGGAGGCTGCCCGTGGAGGTGG - Intergenic
1070566449 10:77606915-77606937 CTGCAGCCAGCCCTTGGTAGTGG + Intronic
1071555769 10:86600191-86600213 CTGGTGTCTGCCCTTAGTCGAGG - Intergenic
1072641703 10:97215914-97215936 CTGCAGCCTGCATTTGGCCCAGG - Intronic
1073054278 10:100689136-100689158 CAGGAGCCTGTCCATGGCGGGGG + Intergenic
1073056543 10:100706919-100706941 CTGGGGCCTGGCCTTGGCCTGGG - Intergenic
1073488814 10:103839086-103839108 CTGAAGGCGGCCCTTGGCTGTGG + Intronic
1074110656 10:110420540-110420562 CTGGAGCCCTTCCTTGGCCCAGG - Intergenic
1074941320 10:118238409-118238431 TTGGAGCCTGGCCCTGGCCCTGG + Intergenic
1076023006 10:127089612-127089634 CTGAAGCCTGGACTTGGCCAGGG - Intronic
1076209363 10:128627990-128628012 AGGCAGCCTGCCCTTGGCCCAGG + Intergenic
1076373047 10:129967181-129967203 GCGGAGCCTGACCTTTGCCGGGG + Intergenic
1076591652 10:131587619-131587641 CTGGGTCCTGCCCTGGGCCTTGG - Intergenic
1076631389 10:131854238-131854260 CTGGCGCCTCCGCCTGGCCGTGG - Intergenic
1076875740 10:133214719-133214741 CTGGAGCTTGACCTTGACCTTGG - Intronic
1076920002 10:133446367-133446389 CTGGAGTCTGCACCTGCCCGAGG - Intergenic
1077130724 11:971171-971193 CTTGGGCCTGCCCTTGTCCTGGG + Intronic
1077179101 11:1204248-1204270 CTGGAGTATGGCCTTGGCGGAGG + Intergenic
1077442067 11:2573550-2573572 CTGGAGCCGGGCCTGGGCAGTGG + Intronic
1078338008 11:10478811-10478833 CTGGAGCCTGGCCCTGTCCGTGG + Intronic
1078679546 11:13463031-13463053 CGGGAGGCTGGGCTTGGCCGGGG - Intronic
1078771846 11:14358861-14358883 CTGTAGCGTCCCCATGGCCGCGG - Exonic
1083301881 11:61743926-61743948 CTGGAGGCGGCCCTGGGCAGTGG + Exonic
1083620703 11:64048080-64048102 CTGCAGCCTGCCCTGGCCGGCGG + Intronic
1083684522 11:64368504-64368526 CGGGAGCCTGCGCTGGGCCAGGG + Exonic
1083856702 11:65396594-65396616 CTGGAGTCTGCCCTTCGGAGGGG + Intronic
1084087116 11:66859832-66859854 CGGGACCCTGACCGTGGCCGTGG + Exonic
1084213311 11:67633811-67633833 CTGGACCCTGCCTTTGCCCCAGG + Intronic
1084736331 11:71108048-71108070 CTGGAGGCAGCCTTTGGCCGTGG - Intronic
1085182029 11:74544029-74544051 CTGGAGGATGGCCTTGGCCTAGG + Intronic
1085182049 11:74544094-74544116 CTGGAGGATGGCCTTGGCCTGGG + Intronic
1086419888 11:86628312-86628334 CTGGAGCCTGTTCTGGGCCCTGG + Intronic
1090445500 11:126761396-126761418 CTGGACACTGCCCTTTGCTGGGG - Intronic
1090788476 11:130070003-130070025 CAGGAGCCTGCCCGTGGCTGCGG - Exonic
1090799874 11:130163726-130163748 CTGGAGCCTTCCCTCTGCCTTGG + Intronic
1092502895 12:9065355-9065377 CTGGAGCCTGCAGTGGGCAGGGG - Intergenic
1093027163 12:14255419-14255441 TTGAAGCCTGCCCTTGTCTGAGG + Intergenic
1093111860 12:15162266-15162288 CTGGAGGCAGTCCTTGGCCAGGG - Intronic
1095865393 12:46966175-46966197 CTGCTGGCTGCCCTTGGCCATGG - Intergenic
1096409021 12:51364176-51364198 CTGGAGCCTGACCTTCGGCTGGG - Exonic
1101586298 12:106088811-106088833 CTGGAACCTACCCTAGGCCTGGG + Intronic
1102460976 12:113099446-113099468 CTGTACCCTGCCCTTGGCCTAGG - Exonic
1103556522 12:121770006-121770028 CTGAAGCTTGCACTTGGACGAGG + Intronic
1104766447 12:131333295-131333317 CTCCACCCTGGCCTTGGCCGTGG - Intergenic
1104962530 12:132495075-132495097 CTGTACCCTCCCCTTGGCCAAGG - Intronic
1105281031 13:18962745-18962767 CTGGAGCCTGGGCTGGGCCGGGG - Intergenic
1105290233 13:19048757-19048779 CTGGAGCCTGGGCTGGGCCGGGG - Intergenic
1105432619 13:20350977-20350999 CAGGAGCCTGCCCCTCCCCGAGG - Intergenic
1106038755 13:26069679-26069701 CCGTGGCCTGCCCGTGGCCGTGG + Intergenic
1106684647 13:32045329-32045351 CTGGAACCAGGCCTTGGCAGAGG - Intronic
1111999223 13:95194292-95194314 CTGCAGCCTCCCCTCGGCCTTGG + Intronic
1113887657 13:113669421-113669443 CTTGAGCCTCCCCTTGCCAGAGG + Intronic
1114406669 14:22463343-22463365 CTATAGCCTGCCATTGGCAGGGG + Intergenic
1117012188 14:51482297-51482319 CTGGAGCCAGCCCTCGCACGTGG + Intergenic
1122072224 14:99212334-99212356 CTGCAGCCTCCCCTGGGCCTGGG + Intronic
1122587618 14:102820257-102820279 CTGGATCCTGCCCTTGGGTCTGG + Intronic
1122775055 14:104113391-104113413 CACGAGGCTGCCCTTGGCCTTGG - Exonic
1122783565 14:104153826-104153848 CTGCACCCTGCCCGTGGCTGAGG + Intronic
1122993110 14:105248249-105248271 CCGGAGTCTGCCTCTGGCCGCGG - Intronic
1123480484 15:20626956-20626978 CTGGAGTATGCTCTTGGCCTGGG + Intergenic
1123637524 15:22373411-22373433 CTGGAGTATGCTCTTGGCCTGGG - Intergenic
1125347358 15:38731825-38731847 CTCAAGCCTGCCCTTAGCAGTGG - Intergenic
1127286469 15:57538016-57538038 CTGGCACCTGCCCTGGGGCGGGG - Intronic
1128159090 15:65411281-65411303 CTGCAGCCTGCTCTGGGCCCAGG + Exonic
1129321980 15:74780589-74780611 CTGGAGCCAGCCCTTTGGAGAGG - Intergenic
1129774887 15:78230122-78230144 CTTGAGCCTGCCCAGGGCCTGGG - Intronic
1131337919 15:91567781-91567803 CAGGTGGCTGCCCTTGGCCCAGG - Intergenic
1132750248 16:1454296-1454318 CTGGAGCCTGCCCTCATCCCAGG - Intronic
1132956424 16:2596743-2596765 CAGGAGCCTGCGCTTGGAAGTGG - Intronic
1133219973 16:4315791-4315813 CGGGAGCCGGCGCTGGGCCGAGG - Intronic
1133315387 16:4880395-4880417 CTGGGGCTTGCGCTGGGCCGTGG + Exonic
1134149953 16:11797517-11797539 CTGGGGCCTCGCCTGGGCCGCGG + Intergenic
1136297321 16:29311129-29311151 CTGTAGCCAGCCCTGGGCCTTGG + Intergenic
1137604823 16:49780411-49780433 CTGGAGCCTCCCCCTGCCAGGGG + Intronic
1137711121 16:50567601-50567623 CTGTGGCCTGTCCTTGGCCAAGG - Intronic
1137719286 16:50618545-50618567 CTGGCGCCTGCCCCTGGCATTGG + Intronic
1137726591 16:50660782-50660804 CTGCAGCCTGCCCATAGCCCCGG + Intergenic
1139715098 16:68806779-68806801 CCAGAGCCTGCCCTTGGCGCAGG + Intronic
1139882737 16:70188303-70188325 CGGGACCCGCCCCTTGGCCGGGG + Intergenic
1140369773 16:74407216-74407238 CGGGACCCGCCCCTTGGCCGGGG - Intergenic
1140774881 16:78240430-78240452 CTGGGGGCTGCCCATGACCGTGG - Intronic
1141191244 16:81826270-81826292 CTGGAGCCTTGCCGTGGCAGAGG - Intronic
1141643496 16:85355144-85355166 GTGGGGCCTGCGCTTGCCCGAGG + Intergenic
1141710354 16:85695363-85695385 GTGGCGCCTAACCTTGGCCGAGG - Intronic
1142307861 16:89295561-89295583 CTGGAGCACGGCCTTGGCCTGGG + Intronic
1143723588 17:8830599-8830621 CTGGATCCTGCCAATGGCCCTGG + Intronic
1144260095 17:13510131-13510153 GAGGGGCCTGCCCTTGGCCCAGG - Intronic
1144516026 17:15917937-15917959 CTCGAGCCTGCACTGGGCCCGGG + Intergenic
1146158282 17:30542646-30542668 CTGTAGCTTTCCCTTGGCCCTGG + Intergenic
1146163781 17:30573176-30573198 CTTGAACCTGCCCTGGGCTGAGG + Intergenic
1147202479 17:38812252-38812274 TTGGAGTATGCCCTTGGTCGTGG - Intronic
1148495432 17:48050911-48050933 CTGGAGTGTGTCCTTGGCCTTGG + Exonic
1148579519 17:48734129-48734151 CCGGAGCCTGCGCTTGGCAGGGG + Intergenic
1148736555 17:49868464-49868486 CAGCAGCCTGCCCTTCGCCTGGG + Intergenic
1151541112 17:74764887-74764909 CAGCAGCCTGTCCTTGCCCGGGG + Intronic
1152376383 17:79920881-79920903 CTGGAGCCTGCCCCAGTCCCAGG - Intergenic
1152461709 17:80445332-80445354 CTATAGCCTGGCCTTGGACGAGG + Intergenic
1154126474 18:11696924-11696946 CTGGAGTCAGACCTTGTCCGAGG + Intronic
1156654741 18:39271871-39271893 TTGGAGCCTGCTCTTAGCCTGGG + Intergenic
1157671024 18:49528870-49528892 GTGGACCCTCCCCTTGGCCAAGG + Intergenic
1160668603 19:345004-345026 CTGGACCCTGATCTTGGCCTTGG + Intergenic
1160672245 19:371204-371226 CTGGAGCATGCCCATGTCTGAGG - Exonic
1160685039 19:430699-430721 CTGCAGCCTGCCATGGGACGTGG - Exonic
1161563012 19:4984142-4984164 CTGGAGCCTTCCCTGGGATGAGG - Intronic
1161593149 19:5137713-5137735 GGGGAGCCTGCCCTGGGCTGAGG + Intronic
1161793849 19:6375539-6375561 GTGGAGCCTGACCCTGTCCGTGG - Exonic
1162913584 19:13862865-13862887 ATGGGGCCTGCCCTTGCCCAAGG - Intronic
1163104206 19:15114276-15114298 CTCTTGCCTCCCCTTGGCCGGGG + Exonic
1163513322 19:17748493-17748515 CTGGAGCCTGGACTTGGGGGGGG + Intronic
1164402837 19:27913473-27913495 CTGGAGCCTGCAGGTGGCAGAGG + Intergenic
1166932476 19:46309283-46309305 CTGGAGCCCCCACTGGGCCGAGG + Exonic
1168324219 19:55529972-55529994 CTGGGACCGGCCCCTGGCCGAGG - Exonic
1168697031 19:58409291-58409313 CTGGGGCATGCCCTTGGCAGTGG + Intronic
925276342 2:2650984-2651006 CAGGATCCTGCCCTTGGCATCGG - Intergenic
926120178 2:10237514-10237536 CTGGAGCCCGCCCTGGGCTCTGG + Intergenic
926120191 2:10237554-10237576 CTGGAGCCCGCCCTGGGCTCTGG + Intergenic
927194694 2:20539412-20539434 CTGGACACTGCCCCTGGCCTGGG - Intergenic
930697879 2:54430364-54430386 CTCCAGCCAGCCCCTGGCCGTGG - Intergenic
930701105 2:54457712-54457734 CCCGGGGCTGCCCTTGGCCGAGG + Intronic
931637676 2:64355355-64355377 CTGGAAAGTGCCCTTGGCTGAGG - Intergenic
932144570 2:69306638-69306660 CTGGAGCCAGGACGTGGCCGTGG - Intergenic
934941933 2:98509037-98509059 CTGAAGCCTTCCCTTGGGTGAGG - Intronic
936144772 2:109973312-109973334 CTTGGGCCTGGCCTTGGCCCTGG + Intergenic
936181458 2:110271275-110271297 CTTGGGCCTGGCCTTGGCCCTGG + Intergenic
936199914 2:110398157-110398179 CTTGGGCCTGGCCTTGGCCCTGG - Intergenic
936722086 2:115264369-115264391 CTGGAGCCTATCCTTTGCTGGGG + Intronic
937030827 2:118738878-118738900 TCGGAGCCTGCCCCTGGCCCTGG - Intergenic
937244421 2:120483465-120483487 CTGGTGCCAGCCCCTGGCCCAGG + Intergenic
937885205 2:126894858-126894880 CTGGACCCTGACCATGGCCCTGG - Intergenic
937895130 2:126972261-126972283 CCGGAGCCGGCCCCTGGCCCCGG + Intergenic
938135170 2:128750736-128750758 CTAGAGCCAGCCCTGGGCCGGGG + Intergenic
939499486 2:142965097-142965119 CTGGAGTCTGCACTTGACAGTGG - Intronic
946396533 2:219446169-219446191 AGGGAGCCTCCCCCTGGCCGTGG - Intronic
948535583 2:238644029-238644051 CTGGAGCCTGCTCTAGGACCTGG - Intergenic
948626674 2:239273630-239273652 CTGGAGCCTGCGCCGGACCGGGG - Intronic
1168829151 20:834836-834858 CTGGAGCCTGCCCCTGGCTTTGG + Intronic
1169065733 20:2693288-2693310 CTGGCGGCTGCCCGGGGCCGCGG - Intronic
1169567828 20:6874858-6874880 CTGGGGATTGCCCTTGGCTGAGG - Intergenic
1169595127 20:7189846-7189868 CTGGAGCCTGCTCTTGTCTTTGG + Intergenic
1171032811 20:21692262-21692284 CTGGACCCAGCCCTTGGCTTTGG + Intergenic
1172293738 20:33793425-33793447 CTGGAGCTGGGCCTTGGCCCGGG + Intergenic
1175176178 20:57113818-57113840 ATGGATCCTCCTCTTGGCCGAGG - Intergenic
1175517755 20:59579603-59579625 CTAGAACCTGCCATTGGCCTCGG - Intronic
1175541015 20:59747673-59747695 CTTGAGCCTGGCATTGGCTGTGG + Intronic
1176019044 20:62953287-62953309 CTGGAGCCTGCAGCTGGACGGGG + Intronic
1176073574 20:63238653-63238675 CTGCAGCCTGTGCTTGGCCAAGG + Intronic
1176288786 21:5033611-5033633 CTGCAGCCTCCCCTTGGCATGGG + Intronic
1178505238 21:33157223-33157245 CTGGAGAGTGCCCATGGCCTGGG + Intergenic
1179868398 21:44229864-44229886 CTGCAGCCTCCCCTTGGCATGGG - Intronic
1179916056 21:44479006-44479028 CTGCAGCCTGCCTTTGGGCTTGG - Intergenic
1180110124 21:45643597-45643619 CGCGAGCCTGCCCTTGGGCGGGG + Intergenic
1180188249 21:46150936-46150958 CTGACCTCTGCCCTTGGCCGGGG + Intronic
1181553459 22:23654020-23654042 ATGCAGCCTGCCCTTACCCGGGG + Intergenic
1181690205 22:24555019-24555041 CTGTAGCCCGCTCTGGGCCGGGG - Intronic
1184378819 22:44132234-44132256 CTGGAGCCTGGCCTTGCACCCGG + Intronic
1184523633 22:45009366-45009388 CTGGAGCCTGCCCGGGGGCGGGG - Intronic
1184728138 22:46357956-46357978 CTGGGGCTTGCCCCTGGCCAGGG - Intergenic
950573917 3:13819468-13819490 CTGGGGGCTGCACTTGGCCTTGG - Intronic
951052578 3:18110884-18110906 CTGGGGCCTGTCGTTGGCTGGGG + Intronic
953844655 3:46417903-46417925 CTGGAGGATGCCCCTGGCCTAGG - Intergenic
953928415 3:46994010-46994032 CAGCAGCCTCACCTTGGCCGAGG - Exonic
960851350 3:122058319-122058341 CTGGAGGCTGGCCTTGTCCTGGG - Intronic
960973204 3:123153937-123153959 CTGGAGCCTCCCCTTGCTCAGGG + Intronic
961524301 3:127486771-127486793 CAGGAGCCAGCCCTTCGCCATGG - Intergenic
968442016 4:628967-628989 CTGGAGCCTGGCCCAGGCCTGGG + Intronic
968460479 4:722378-722400 CTGGAGGCTGCCCCAGGCAGCGG + Intronic
968489723 4:883548-883570 CCGGAGGCTGCGCTTGCCCGGGG - Intronic
968582734 4:1402534-1402556 CTGGTGCCTGCCCGTCGTCGTGG - Intergenic
968757407 4:2423906-2423928 CGGGAGCCTGCCCTGGGCCCCGG - Intronic
968951952 4:3699953-3699975 CTGCAGCCTGCTCCTGGCTGTGG + Intergenic
968965311 4:3766452-3766474 CAGCAGCCGGCCCTCGGCCGTGG - Exonic
969303125 4:6309123-6309145 CCCGAGCCTCCCCCTGGCCGTGG - Intergenic
969316301 4:6383246-6383268 CTGGAGGCTGGGCTTGGCCGGGG - Intronic
969886462 4:10219763-10219785 CTAGATCCTGACCTTGGCCAAGG + Intergenic
971758283 4:30730854-30730876 CTGGAGCCTGCCCTTGGCCGTGG + Exonic
972414348 4:38823991-38824013 CGGGCGCCCGACCTTGGCCGTGG - Exonic
972431400 4:38985953-38985975 CTGGAGCCTTCCCTTAGCAGAGG - Intronic
973757619 4:54091253-54091275 CTGGAGCCTGGCGTGGGCTGAGG - Intronic
976152014 4:82101765-82101787 CTGGGACTTGCCCTTGGCTGCGG - Intergenic
977574901 4:98665260-98665282 CTGGAGGATGCCCTAGGCCTAGG - Intergenic
978016886 4:103754919-103754941 CTGGAGAATGCCCTTGGCCTAGG + Intergenic
981524744 4:145698728-145698750 GTGGAGCTTCCCCTTGGCCAAGG - Intronic
986191437 5:5499761-5499783 CTGGAGCCTGCCTTTTTCCTGGG + Intergenic
986195981 5:5536715-5536737 ATAGAGCCTGGCCTTGGCTGAGG - Intergenic
986209862 5:5661761-5661783 CTGGGTCCTGCCATTGGCCGGGG - Intergenic
986486494 5:8243357-8243379 ATGGAGTCTGCACTTGGCCTAGG - Intergenic
987308437 5:16660226-16660248 CTGGAGCCTGAAATTGGCCATGG + Intergenic
989043104 5:37249244-37249266 CCGGACCCTGCCCCTGGCGGAGG - Exonic
992533144 5:77671548-77671570 CTGTAACTTGGCCTTGGCCGTGG - Intergenic
992748032 5:79837959-79837981 CTGGATCCAGCCCTTAGCTGGGG - Intergenic
995532370 5:113104251-113104273 CTGCAGCCTCTCCGTGGCCGAGG - Exonic
997297522 5:132777260-132777282 CTGGAAACTCCCCTTGGCGGCGG + Exonic
1002078771 5:176725650-176725672 CTGGAGTCTTCCCTTGGTGGCGG - Intergenic
1002374990 5:178782276-178782298 CTGGAACCTGGGCATGGCCGTGG - Intergenic
1002536631 5:179879546-179879568 CTGGAGCCAGTCCTGGGCCTGGG - Intronic
1008126922 6:47679187-47679209 GTGGAGCCTCCCATTGGCAGTGG + Intronic
1008516949 6:52327372-52327394 ATGGAGCCTGCCCTGGGAGGGGG + Intergenic
1009886651 6:69631431-69631453 CTCAAGCCTGCCCTAGGCCCAGG - Intergenic
1012602694 6:101117455-101117477 CTGCAGCATGACCTTGGCTGTGG - Intergenic
1016728895 6:147406927-147406949 CCGGTGGCTGCCCTTGGCCCTGG - Intergenic
1017718066 6:157225686-157225708 CCGCAGGCTGCCCTTGGCCTGGG + Intergenic
1017731708 6:157323216-157323238 GTGGAGTCTCCCCTTGGGCGGGG - Intronic
1018169828 6:161136019-161136041 CTCCATCCTGCCCTTGCCCGTGG - Exonic
1018792113 6:167156910-167156932 CTGCTGCCTGCCCTTTGCCTCGG + Exonic
1018911938 6:168106327-168106349 CTGGAACCTGCCTATGGCCCAGG - Intergenic
1018997943 6:168724613-168724635 CTGGAGCCAGCCCGTGGCCCTGG - Intergenic
1019348791 7:543460-543482 CTGGGGACTGGGCTTGGCCGAGG - Intergenic
1019425664 7:975441-975463 CGGGAAGCTGCCCTTGTCCGGGG + Exonic
1019505305 7:1387503-1387525 CTTGCGACTGCCCTTGGCTGAGG + Intergenic
1020899895 7:13991155-13991177 CTGGAATCTCTCCTTGGCCGGGG - Intronic
1021922093 7:25495628-25495650 CTGGCGCCTTCTCTTGCCCGTGG - Intergenic
1022507981 7:30918620-30918642 CTGGAGCCTGCTCTTCCCCAAGG + Intronic
1023221066 7:37920726-37920748 CTGGAGCCTTCCCCGGGCCCTGG + Exonic
1023768808 7:43536371-43536393 ATGGAGCCTCCCCTGGGCAGTGG - Intronic
1024579138 7:50787853-50787875 CTGCAGCCTGTCCTGGGCCAGGG + Intronic
1024606582 7:51027116-51027138 CTAGTGCCTGACCTTGGACGAGG + Intronic
1025104728 7:56161785-56161807 CTGGTACCGGCCCTTGGCCCAGG - Intergenic
1025209325 7:57011819-57011841 CTGGGCCCTTCCCTTGCCCGAGG - Intergenic
1026826450 7:73585137-73585159 CTGAAGCCTGGCCTTGTCAGAGG + Intergenic
1029257497 7:99279471-99279493 CTGGACCCTGTCCTCGACCGGGG + Intergenic
1032095022 7:128933700-128933722 CTGGCTCCTGCCCTTGTCGGTGG - Intergenic
1033579357 7:142717664-142717686 CCTGAGCCTGCCCTTGCCAGAGG + Intergenic
1035556703 8:572599-572621 CTGGGAGCTGCCCTTGGCCATGG + Intergenic
1035726741 8:1829425-1829447 CTGGAGCCAGCCCCTGACCCTGG + Intronic
1036470690 8:9049915-9049937 CTGCAGGCTGCCCTTGGCATGGG - Intronic
1037294801 8:17388820-17388842 CTGGAACCTGGCCTTGGCCTGGG - Intronic
1037467109 8:19171861-19171883 CTGGAGCCTGGCCTAGGAAGTGG - Intergenic
1037855390 8:22367556-22367578 GTGGAGGCTGCACCTGGCCGTGG + Intronic
1039567205 8:38560098-38560120 CTGGTGCCTTCCCTTGGACATGG + Intergenic
1040074350 8:43213945-43213967 CTTGATCCTGCCCCTGGCCTGGG + Intergenic
1041362089 8:57065211-57065233 CTGCAGCCTGCCCCTTGCCAAGG - Intergenic
1041928855 8:63266038-63266060 CTGCAGCCTGCTCTGGGGCGGGG + Intergenic
1046246141 8:111565642-111565664 ATGGACCCTCCCCTTGGCCAAGG + Intergenic
1047621016 8:126608014-126608036 CTGGAGCCTGTCCTGGGGTGGGG - Intergenic
1049163980 8:141115550-141115572 CTGGACCTGGCCCTTGGCCCCGG + Intergenic
1049290084 8:141797255-141797277 CTGGGACCTGCCCATGGGCGAGG + Intergenic
1049401341 8:142428819-142428841 CTGGAGCCAGGCCTTGGACAGGG + Intergenic
1049537841 8:143190174-143190196 CTGGTGCCTGCCCAGGGCGGGGG + Intergenic
1050345268 9:4679797-4679819 CTGGAGCCTCCCTCGGGCCGAGG + Exonic
1053278575 9:36801576-36801598 CCGGGGCATGCCCTTGGCCATGG + Intergenic
1056338898 9:85604032-85604054 CTGGAACCTGCCCTGGGCTGAGG + Intronic
1056740560 9:89250779-89250801 CTGGTGCCTGAACTTGGCCTGGG - Intergenic
1056868392 9:90253042-90253064 ATGGACCCTCCCCTTGGCCAAGG + Intergenic
1057337551 9:94166998-94167020 AGGGAGGCTGCACTTGGCCGCGG - Intergenic
1058073131 9:100621895-100621917 CTGGTGCCTGTCCATGGCCTGGG + Intergenic
1059408363 9:114116418-114116440 CTTGGCCCTGCCCTGGGCCGTGG + Intergenic
1059947094 9:119420494-119420516 CTGGAGGCTGACCTTGGACTTGG - Intergenic
1061130542 9:128705592-128705614 CTGGCCCCTGGCCTTGGCCCTGG + Intronic
1061907060 9:133704214-133704236 CTGGAGCCTGGCCTGGGCTGTGG + Intronic
1062161493 9:135082841-135082863 GTGGAGCCTGGACTTGGCCTCGG - Intronic
1062229613 9:135474428-135474450 CAGGAGCCTGCCCAGGGCGGGGG - Intergenic
1062389716 9:136329127-136329149 CAGGAGCCAGCCCCTGGCAGGGG + Intronic
1062407757 9:136404988-136405010 GTGCAGCCTGCCCTTGGGAGCGG - Intronic
1062443374 9:136583424-136583446 CTGGTGCCTGCACTGGGCCCGGG - Intergenic
1062523510 9:136969277-136969299 CTGGAGCCTGCCCCGGGCCAGGG + Exonic
1062600870 9:137318128-137318150 CTGGAGCCTGCCGTGGACAGGGG - Intronic
1062630577 9:137461409-137461431 CTGGAGCCTGGGCGTGGACGTGG + Intronic
1187223824 X:17356336-17356358 CTGGGGCCTCCCATTGGCTGAGG + Intergenic
1191200671 X:57777974-57777996 CTGGAGCCTGTCATGGGCTGGGG - Intergenic
1192679971 X:73242113-73242135 TTTGAGCCTGCCCTGGGCCAGGG + Intergenic
1195051245 X:101098707-101098729 CTGTAGCCTGCACTAGGCCTAGG - Intronic
1197179882 X:123522854-123522876 CTGGAGCCTGTCATTGGTGGGGG - Intergenic
1200119713 X:153784544-153784566 GTGGCCCCTGCCCTTGGCCATGG - Intronic