ID: 971758576

View in Genome Browser
Species Human (GRCh38)
Location 4:30734889-30734911
Sequence TTGGAGACACCCACCCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 65, 4: 245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971758576_971758580 6 Left 971758576 4:30734889-30734911 CCCTGCTGGGTGGGTGTCTCCAA 0: 1
1: 0
2: 1
3: 65
4: 245
Right 971758580 4:30734918-30734940 AGTCTACCTGCTGTGTTGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 100
971758576_971758583 28 Left 971758576 4:30734889-30734911 CCCTGCTGGGTGGGTGTCTCCAA 0: 1
1: 0
2: 1
3: 65
4: 245
Right 971758583 4:30734940-30734962 GAGTCCCTGCCTTCCTTGTGTGG 0: 1
1: 0
2: 0
3: 18
4: 216
971758576_971758579 2 Left 971758576 4:30734889-30734911 CCCTGCTGGGTGGGTGTCTCCAA 0: 1
1: 0
2: 1
3: 65
4: 245
Right 971758579 4:30734914-30734936 TGAAAGTCTACCTGCTGTGTTGG 0: 1
1: 0
2: 1
3: 11
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971758576 Original CRISPR TTGGAGACACCCACCCAGCA GGG (reversed) Intronic
900479134 1:2889772-2889794 TTGGTCACCCCCACCAAGCATGG - Intergenic
900663241 1:3796491-3796513 TGGCAGGCACCCACCCACCAGGG + Exonic
900948883 1:5846389-5846411 TTTGGGACTCCCACCCAGCCTGG - Intergenic
902144576 1:14387591-14387613 TGGGAGGCACCCCCCAAGCAGGG - Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
906240185 1:44238058-44238080 TTGGAGCCAGGCAGCCAGCACGG + Intronic
906909774 1:49935572-49935594 TGGGAGGCACCCCCCCAGTAGGG + Intronic
907856867 1:58312157-58312179 TTAGAGCCACACACCGAGCAGGG - Intronic
908665161 1:66481650-66481672 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
908876808 1:68686899-68686921 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
909560482 1:77004769-77004791 TGGGAGGCACCCCTCCAGCAGGG - Intronic
910369751 1:86503319-86503341 TTGGAGGCACCCCTCCAGCAGGG - Intergenic
914151999 1:145051423-145051445 TTAGAAACACCCCCACAGCATGG + Intronic
915486710 1:156226432-156226454 ATGCAGAAACCAACCCAGCAGGG - Intronic
916032846 1:160893240-160893262 TGGAAGACACCCCCCCAGTAGGG + Intergenic
917538213 1:175889731-175889753 TTGAAGAAACCCTCCCAGCAGGG + Intergenic
919454246 1:197803058-197803080 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
921172974 1:212565588-212565610 TGGGTGGCACCCACCCAGCAGGG - Intronic
921226656 1:213026951-213026973 TTGAACACAGCCACCCACCAGGG - Intergenic
921307089 1:213808182-213808204 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
922801634 1:228367278-228367300 GTGGCGACAGCCACCCAGCCAGG + Intronic
923992897 1:239458881-239458903 TGGGAGACCCCCCCCCATCAGGG + Intronic
924816130 1:247443579-247443601 CTGCAGACACCCACACTGCAGGG - Intronic
1063884257 10:10561787-10561809 TAGAAGACACCCAGCCAGGAAGG - Intergenic
1063884451 10:10563231-10563253 TAGAAGACACCCAGCCAGGAAGG + Intergenic
1064671767 10:17722219-17722241 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1064802648 10:19093869-19093891 TGGGAGGCACCCCCCCAGCAGGG - Intronic
1069124701 10:64615840-64615862 TGGGAGAGTCCCACCCTGCAGGG - Intergenic
1069705469 10:70456640-70456662 TTGGAGGGACCCACCCTGCTGGG + Intergenic
1070978050 10:80621567-80621589 TTGGAGAGACCCATCAAGCAAGG - Intronic
1071248000 10:83786337-83786359 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1071352589 10:84762142-84762164 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1073581311 10:104668107-104668129 TTGCAGACCTCCAACCAGCAAGG - Intronic
1074044710 10:109826553-109826575 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1075579735 10:123608229-123608251 TTGGAGTGACGCACCCAACAAGG - Intergenic
1076496627 10:130901632-130901654 AAGGAGTCACCCTCCCAGCAGGG - Intergenic
1078759097 11:14237357-14237379 TTGGAGAAAGCCACCAACCAGGG + Intronic
1079091040 11:17480474-17480496 TGGGGGACAGCCACCCAGAAAGG + Intergenic
1080447710 11:32352650-32352672 TTGGAGAGGCCCACACAGCAAGG - Intergenic
1083658245 11:64240625-64240647 TTGATGACACCCACCCCACAGGG - Intergenic
1083769005 11:64856058-64856080 TGGGAGAATCCCACCCCGCAGGG - Intronic
1085222005 11:74882788-74882810 TGGGAGGCACCCCCCCAGCAGGG - Intronic
1085402770 11:76244450-76244472 CTGGCCACACCCACCCAGGAGGG - Intergenic
1085525557 11:77161595-77161617 TTTGAGACATCCAAACAGCAAGG - Intronic
1086544476 11:87951803-87951825 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1086843580 11:91719678-91719700 TTGTAGCTACCCATCCAGCAGGG - Intergenic
1087052894 11:93904311-93904333 TTGGAGAGACCCAGGCAGCTGGG + Intergenic
1087067163 11:94037583-94037605 TGGGAGGCACCCCCCCAACAGGG + Intronic
1088498165 11:110453582-110453604 TTGGAGACACCTAACCAAAAAGG - Intronic
1091160114 11:133412231-133412253 TTGGAGAGGCCCACCTAGGAGGG + Intronic
1093163791 12:15781790-15781812 TTGGAGAGTCCCCACCAGCAAGG - Intronic
1093217648 12:16382544-16382566 TGGGAGGCACCCCCCCAGTAGGG - Intronic
1093320193 12:17704789-17704811 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1093693765 12:22137259-22137281 TGGGAGGCACCCCCCCAGCAGGG + Intronic
1093781911 12:23146565-23146587 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
1094744824 12:33332579-33332601 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1095712867 12:45308788-45308810 CTGGAGAAAGCCACACAGCAGGG - Intronic
1098464012 12:70765749-70765771 TGGGAGGCACCCCCCCAGAAGGG + Intronic
1099193815 12:79590789-79590811 TTGGAGACTCTTACCCAGCATGG - Exonic
1100709760 12:97243217-97243239 TTGAAGACACCAACAGAGCAAGG - Intergenic
1103347382 12:120260192-120260214 TTGGGGACACACACTCAGGATGG - Intronic
1105311477 13:19216126-19216148 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1106810521 13:33354000-33354022 TTGGAGATACCCATCCGGAAGGG - Intergenic
1108502339 13:51080098-51080120 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1109312373 13:60710478-60710500 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1109719521 13:66259042-66259064 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1109825869 13:67721459-67721481 TTGTAGACACCCTAGCAGCATGG + Intergenic
1110721388 13:78766273-78766295 TTGGAGTCAGGCACCCAGCAAGG - Intergenic
1112015967 13:95331790-95331812 TTGGAGAGACCCACTCGGCAAGG + Intergenic
1113086627 13:106575484-106575506 TGGGGGACACCCACCCAGAAAGG - Intergenic
1113667638 13:112151955-112151977 ATGGATACACCCACCCTGCTGGG + Intergenic
1114517124 14:23307271-23307293 AAGGAGACACTCACCCAGCCGGG - Exonic
1114807705 14:25857261-25857283 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1114828286 14:26107138-26107160 TAGGAGGCACCCCCCCAGCAGGG + Intergenic
1115078005 14:29414467-29414489 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
1115719778 14:36147940-36147962 TGGGAGGCACCCCCCGAGCAGGG - Intergenic
1116322887 14:43492904-43492926 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1117402825 14:55372866-55372888 GTGGAGAAACCCACCTGGCACGG + Intronic
1117528988 14:56640231-56640253 TGGGAGGCACCCTCCCAGTAGGG + Intronic
1117663612 14:58033266-58033288 TGGGAGGCACCCCCCCAGCAGGG + Intronic
1117809580 14:59532588-59532610 TTGGTCACACCCACCCACAAGGG - Intronic
1118896026 14:69946380-69946402 TTGGAGTCATCCACTCTGCAAGG + Intronic
1118958180 14:70502035-70502057 TGGGAGCCACCCCCCCAGTAGGG + Intergenic
1119156299 14:72414958-72414980 TGGGAGGCACCCCCCCAGTAGGG - Intronic
1120595527 14:86430568-86430590 TTGGAAACACATACCCAGCAGGG - Intergenic
1122045177 14:99017863-99017885 CTGGAGACTCCTAGCCAGCAAGG + Intergenic
1122983306 14:105201219-105201241 TGGGAGACATGTACCCAGCATGG - Intergenic
1125226737 15:37404727-37404749 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1125610387 15:40965497-40965519 CAGGAGCCACCCACCCAGCCTGG + Intergenic
1126933911 15:53684924-53684946 TGGGAGGCACCCCCCTAGCAGGG + Intronic
1126962641 15:54014905-54014927 TTGGATTCATCCACCCAGGAAGG + Exonic
1127149219 15:56056261-56056283 TTGGAGACCCCAAGCCACCATGG - Intergenic
1128314480 15:66652047-66652069 TTGCAAACACAGACCCAGCATGG + Intronic
1128942228 15:71798426-71798448 TGGGAAGCACCCCCCCAGCAGGG - Intronic
1129185264 15:73902289-73902311 TTGTTGACACCTCCCCAGCAAGG + Intergenic
1129452918 15:75660831-75660853 TTGGAGACACCACCCCTGGAGGG + Exonic
1129821924 15:78608299-78608321 TGGGAGACACCCCCCAAGTAGGG + Intronic
1131331283 15:91501347-91501369 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1132592839 16:733862-733884 CTGAAGACACTCAGCCAGCAGGG - Intronic
1132679848 16:1135218-1135240 TGTGAGACCCCCGCCCAGCACGG + Intergenic
1132859796 16:2064554-2064576 CTCGGGACACCCACCCTGCAGGG - Intronic
1133165859 16:3946842-3946864 TTGGGGACACCCCTGCAGCAGGG + Intergenic
1134378211 16:13699394-13699416 ATGGAGAGGCCCACACAGCAAGG + Intergenic
1137471079 16:48759126-48759148 TTGGAGGCCCCTCCCCAGCAAGG - Intergenic
1137477344 16:48820652-48820674 TCAGAGAGATCCACCCAGCAAGG - Intergenic
1138502629 16:57457253-57457275 TAGGAGAACCCCACCCAGGATGG - Intronic
1139282197 16:65780531-65780553 TTGGAGGCCCCCCCCCACCAAGG - Intergenic
1139938887 16:70590788-70590810 TGGGAGACTTCCACCCAGGATGG - Intronic
1140017913 16:71206040-71206062 TTGGAAACACCCAGACAGTAGGG + Intronic
1141437524 16:84008863-84008885 TTGGAGTCATCCACCCTCCACGG + Intergenic
1141966988 16:87452318-87452340 ATGCAGTCGCCCACCCAGCATGG - Intronic
1143284978 17:5782206-5782228 TTGAAGACACACACCTAGGAAGG + Intronic
1145712361 17:26989466-26989488 GTGGAGACAGCCACCTGGCAGGG + Intergenic
1146752569 17:35394666-35394688 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1150618307 17:66789288-66789310 TTGTGGACTCGCACCCAGCAGGG + Intronic
1151290647 17:73147457-73147479 TTGGAGACACTCATACAACAGGG - Intergenic
1152460178 17:80438382-80438404 CTGCAGACCCCCACCCTGCAGGG - Intergenic
1152534409 17:80942128-80942150 CTGGAGACGCTCATCCAGCAGGG - Intronic
1152569835 17:81116801-81116823 CTGGAGACACCTCCCCAGCCAGG - Exonic
1152945060 17:83193635-83193657 CAGGAGACACACACCCAGCTGGG + Intergenic
1153058904 18:976135-976157 TGGGAGGCACCCCCCCAACAGGG - Intergenic
1154395144 18:13981142-13981164 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1156176928 18:34557646-34557668 TGGGAGGCACCCCCCCAGCAGGG - Intronic
1156378720 18:36537514-36537536 TCTCTGACACCCACCCAGCAAGG - Intronic
1157274317 18:46299647-46299669 TAGGAGACAGCCACACAGCGGGG + Intergenic
1160007349 18:75077021-75077043 CTGGAGAAATCCAACCAGCAAGG + Intergenic
1160485652 18:79290018-79290040 TGGGAGGCACCCCCCAAGCAGGG - Intronic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1162307596 19:9884753-9884775 ATGCAGACACCCACCATGCAAGG - Intronic
1163183287 19:15618850-15618872 TAGGAGACACCACCCCAGCCTGG + Intronic
1164843232 19:31410370-31410392 AAGGAGACACCCACACACCAAGG + Intergenic
1166267794 19:41695800-41695822 CTGAATCCACCCACCCAGCAAGG - Intronic
1166613912 19:44226187-44226209 TGGGAGACACCCCCCCAGTAGGG - Intronic
1166630777 19:44405477-44405499 TTGTAGCCACCCAAACAGCATGG + Intergenic
1168366643 19:55793536-55793558 TTGGAGACAGTCACCCAGGCTGG - Intronic
925361261 2:3282179-3282201 TTGCCGACACCAACCCAGCAGGG - Intronic
925707211 2:6698095-6698117 TTGGTTACACCCACCCAGAGTGG - Intergenic
925848192 2:8052544-8052566 TAGGAGCCAACCACCCACCATGG - Intergenic
927565125 2:24105047-24105069 CTGGAAACACCCAGACAGCAGGG + Intronic
928759098 2:34560716-34560738 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
931048733 2:58386817-58386839 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
931843436 2:66177899-66177921 TGGGAGGCAACCCCCCAGCAGGG + Intergenic
933190638 2:79329933-79329955 TTGGAGGCACCCACCCTGCTGGG - Intronic
936407771 2:112222410-112222432 CTGGAAACACCCAGACAGCAGGG - Intronic
936782795 2:116054219-116054241 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
937039627 2:118810843-118810865 GTGCAGACACTCACACAGCACGG + Intergenic
937561531 2:123230811-123230833 CTGGAGCTAGCCACCCAGCAGGG + Intergenic
937809412 2:126183315-126183337 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
940836075 2:158523345-158523367 CGGGAGGCACCCCCCCAGCAGGG + Intronic
943520275 2:188940918-188940940 TTGGAGAAACCCAGCCAGTACGG - Intergenic
943549377 2:189319900-189319922 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
944421639 2:199537050-199537072 TGGGAGACACCCTCCCGGTAGGG + Intergenic
944570122 2:201036008-201036030 TTGGAGGCACCCCCCCAGTAGGG - Intronic
1168882323 20:1217468-1217490 TGGGAGGCACCCCCCCAGTATGG + Intergenic
1169051615 20:2583360-2583382 TTGGAGATGCCCACCTGGCAAGG + Intronic
1170010048 20:11712967-11712989 ATGGAGCCAGGCACCCAGCAGGG - Intergenic
1170983750 20:21239340-21239362 TTGTAGACACCCGCCCCACAGGG - Intronic
1171255166 20:23684960-23684982 TAGGAGACAACCTCCCAGCCTGG + Intergenic
1171262510 20:23746884-23746906 TAGGAGACAACCTCCCAGCCTGG + Intergenic
1171271607 20:23822603-23822625 TAGGAGACAACCTCCCAGCATGG + Intergenic
1172012620 20:31854739-31854761 TCAGACACACACACCCAGCAAGG - Intronic
1172035286 20:32006345-32006367 TTGGACACACCGAGACAGCAGGG - Intergenic
1173579112 20:44133459-44133481 TTGGGGGCAGCCACACAGCAGGG + Intronic
1173851613 20:46222090-46222112 ATGGAGACACCCACCTGGTAGGG + Intronic
1175383079 20:58577105-58577127 TAGGAGAAACCCAGACAGCACGG + Intergenic
1175401055 20:58700108-58700130 TTTGAGCCACCCTCCGAGCAAGG + Intronic
1176003090 20:62842916-62842938 TTGGGGAGACCCTGCCAGCAGGG + Intronic
1176292557 21:5053949-5053971 TGGGATACACCCCCCCAACACGG - Intergenic
1176759833 21:10770480-10770502 TAGGAGGCACCCAACCAGCAGGG + Intergenic
1177399866 21:20588463-20588485 ATGCAGACACACACCCAGGAGGG + Intergenic
1178749538 21:35287340-35287362 TTGGGGAACCCCACACAGCAAGG + Intronic
1179864701 21:44209701-44209723 TGGGATACACCCCCCCAACATGG + Intergenic
1180504863 22:15985368-15985390 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1180944036 22:19679838-19679860 TTGGAGACGCCCACCCAGTGGGG - Intergenic
1183031347 22:35108669-35108691 TCTGAGACACCACCCCAGCAAGG + Intergenic
1184301973 22:43566809-43566831 TTTGAGACGCCCACCCAGGGAGG + Intronic
1203333797 22_KI270739v1_random:36678-36700 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
950646838 3:14382411-14382433 TGGGAGAAAGCCACCCAGGAAGG + Intergenic
951572932 3:24084356-24084378 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
953404089 3:42651981-42652003 CTGGAGACGCTCACCCAGCAAGG - Intergenic
954380385 3:50216018-50216040 TTGGAGACCCCCCTCCAGAAGGG + Intronic
954457826 3:50609544-50609566 TAGGGGAAGCCCACCCAGCAGGG + Intronic
954497432 3:50978422-50978444 TGGGAGGCACCCCCCCAGCAGGG - Intronic
954986931 3:54802795-54802817 TGGGAGGCACCCCCCCAGTAGGG + Intronic
955014082 3:55051382-55051404 TGGGAGGCACCCCCCCAGCAGGG - Intronic
955472089 3:59296204-59296226 TGGGAAACACCCAGACAGCAGGG + Intergenic
956707429 3:72011434-72011456 TTGGAGACTCCCAGGAAGCATGG - Intergenic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
962251417 3:133838319-133838341 GAGGAGGGACCCACCCAGCAGGG + Intronic
966230555 3:177647018-177647040 TTGGAGAGACACACACAGCCTGG + Intergenic
966749503 3:183308687-183308709 TTGGAGACACACACCCCTAAAGG - Intronic
967025571 3:185561164-185561186 CTGGAGGCACCCCTCCAGCAGGG - Intergenic
969540308 4:7784495-7784517 TGGGAGACACCCAGCCAATAAGG + Intronic
969643165 4:8411298-8411320 TTGTAGCCTCCCACCCTGCAGGG - Intronic
970083714 4:12320991-12321013 TTTGAAACACCCATCCAGGAGGG - Intergenic
970283310 4:14481477-14481499 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
970985052 4:22147150-22147172 TGGGAGGCACCCCCCGAGCAGGG + Intergenic
971116022 4:23647022-23647044 TGGGAGGCACCCCCCAAGCAGGG - Intergenic
971758576 4:30734889-30734911 TTGGAGACACCCACCCAGCAGGG - Intronic
972177707 4:36427986-36428008 CTGGAGGCACCCAGACAGCAGGG + Intergenic
973579228 4:52325065-52325087 TGGGAGGCACCCCCCAAGCAGGG - Intergenic
974967053 4:68773621-68773643 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
976529505 4:86135400-86135422 TGGGAGGCACCGCCCCAGCAGGG + Intronic
977881702 4:102211961-102211983 TTCGATAGACGCACCCAGCAGGG - Intergenic
979096177 4:116553732-116553754 TTAGAGACACCCATCCCTCAAGG - Intergenic
979432424 4:120647739-120647761 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
979915501 4:126427994-126428016 CTGGAGATGCCGACCCAGCAGGG + Intergenic
982581109 4:157180167-157180189 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
982619990 4:157692218-157692240 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
982675232 4:158367952-158367974 TGGGAGGCACCCCCCCAGTAGGG - Intronic
982691201 4:158549856-158549878 TGGGAGGCACCCCCCCAGTAGGG - Intronic
982836468 4:160125486-160125508 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
983119083 4:163858219-163858241 TTGGAGAAATCAGCCCAGCAGGG - Intronic
983602660 4:169548404-169548426 TGGGAGACACCTCCCCAGTAGGG - Intronic
985728191 5:1526550-1526572 GTGGAGACCACCACCCTGCAGGG + Intergenic
989292764 5:39788377-39788399 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
989662333 5:43813581-43813603 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
991543251 5:67752555-67752577 TTGGATCCTGCCACCCAGCAGGG - Intergenic
992167950 5:74073527-74073549 TTGGCTACACCCACCCAGAGTGG + Intergenic
992620087 5:78584561-78584583 TGGGAGGCACCCCCCCAGCAGGG - Intronic
993871741 5:93261764-93261786 TGGGAGGCACCCCCTCAGCAGGG + Intergenic
994021450 5:95030290-95030312 GTGGAAACACCCACCCTGAAGGG - Intronic
994235299 5:97355952-97355974 TTGGAAAGTCCCACCCAGCGAGG + Intergenic
995329905 5:110934702-110934724 TGGGAGGCACCCCCACAGCAGGG + Intergenic
996419033 5:123241886-123241908 TGGGAGGCACCTCCCCAGCAGGG - Intergenic
996826714 5:127690960-127690982 TTGGAGAGACCCTCCTGGCAAGG + Intergenic
998595935 5:143530534-143530556 TTTGGCACACCCAGCCAGCAAGG + Intergenic
999952674 5:156666981-156667003 TTTGGGACACCCAACCTGCATGG - Intronic
1000803396 5:165757574-165757596 TTGAAGACACACAACCAGCCGGG - Intergenic
1001844026 5:174904723-174904745 CTGGAGACTCCAAGCCAGCAGGG + Intergenic
1001897490 5:175394025-175394047 TTGGAGACACCCAAACACCCTGG + Intergenic
1002568481 5:180127368-180127390 TGGGGGTCACCCACCCAGCGAGG - Intronic
1002657452 5:180762075-180762097 TGGGAGACACCCCCCCAGTAGGG - Intergenic
1005656455 6:27943489-27943511 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1006934854 6:37710210-37710232 TTAATGACACCCACCCAGCCAGG + Intergenic
1008236586 6:49058369-49058391 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
1008485184 6:52027815-52027837 TAAGAGCCACTCACCCAGCAGGG + Exonic
1011338109 6:86283539-86283561 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1012540423 6:100355430-100355452 TGGGAGGCAGCCCCCCAGCAGGG + Intergenic
1014132175 6:117846806-117846828 CTGGAAACACCCAGACAGCAGGG + Intergenic
1014605862 6:123472807-123472829 TGGGAGGCAACCCCCCAGCAGGG + Intronic
1014954053 6:127594008-127594030 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1015179582 6:130346815-130346837 TGGGAGGCACCCCCCCAGTAGGG + Intronic
1015658855 6:135550374-135550396 TTTGACACACCCACACATCACGG - Intergenic
1018356424 6:163022020-163022042 TCGGAGACTGCCTCCCAGCAGGG - Intronic
1018420048 6:163633326-163633348 GTGGAGAGGCCCACCCGGCAAGG - Intergenic
1019274504 7:168669-168691 ACGGAGACACCCAGCCAACAAGG - Intergenic
1019340485 7:506742-506764 AAGGAAACACCCACCCAGCTAGG + Intronic
1019881052 7:3861493-3861515 TTGGTGGCACCCAAGCAGCAGGG - Intronic
1020330304 7:7011209-7011231 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1022466677 7:30656733-30656755 ATGGGGACCCACACCCAGCAGGG - Intronic
1026153719 7:67809697-67809719 TGGGAGACAACCACCCACAAAGG - Intergenic
1026352121 7:69526501-69526523 TTGGCTGCACCCACCCAGGATGG + Intergenic
1027792418 7:82650575-82650597 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
1029422655 7:100479134-100479156 GCGGAGACACGGACCCAGCAGGG - Exonic
1030132018 7:106209443-106209465 TGGGAGGCACCCCCCCAACAGGG + Intergenic
1032522946 7:132560217-132560239 TTGGAGGCACGCACCGAGGAAGG + Intronic
1034637976 7:152582430-152582452 TTAGAAAAACCCACCCAGCCAGG + Intergenic
1034677187 7:152900413-152900435 CTGGACACAGACACCCAGCAGGG - Intergenic
1036631903 8:10521801-10521823 CAGGAGAAAGCCACCCAGCAGGG - Intergenic
1037833589 8:22203135-22203157 TTGGACACACCCAGCAGGCAAGG - Intronic
1038803304 8:30768698-30768720 ATGGAGAGGCCCACACAGCAAGG + Intergenic
1041018017 8:53610233-53610255 TGGGAGGCACCCCCACAGCAGGG + Intergenic
1041371299 8:57163908-57163930 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1041463069 8:58132638-58132660 TAGGAGACATCCACCCTGCCTGG + Intronic
1044061893 8:87648741-87648763 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
1049285778 8:141774446-141774468 TTGGGGACACCCATACGGCAAGG - Intergenic
1052120006 9:24702880-24702902 TTGGCTGCACCCACCCAGGATGG - Intergenic
1053282028 9:36826672-36826694 GTGGAGAGGACCACCCAGCAGGG - Intergenic
1054425488 9:65062720-65062742 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1054946265 9:70799121-70799143 TTGTAGACATCCTTCCAGCAAGG - Intronic
1055380977 9:75706504-75706526 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1055853449 9:80659387-80659409 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1056051515 9:82774625-82774647 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1059922039 9:119169845-119169867 TGGGAGGCACCCCGCCAGCAGGG + Intronic
1060827473 9:126695243-126695265 TCGGGGACCCCCACCCAGCTCGG + Intronic
1061422593 9:130480317-130480339 TCAGAGTCACCCACCCAGCTGGG - Intronic
1203397907 Un_KI270519v1:44594-44616 TGGGAGGCACCCACCCAGCAGGG + Intergenic
1185666298 X:1767970-1767992 TTGGAGACCCCCACATAGGATGG - Intergenic
1186041231 X:5481175-5481197 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1186611064 X:11139056-11139078 GTGGAGACACCCACGGACCAGGG - Exonic
1187514040 X:19949582-19949604 CTGGAGACTTTCACCCAGCAAGG + Intronic
1188935950 X:36175577-36175599 TGGGAGGCACCACCCCAGCAGGG - Intergenic
1189026279 X:37398216-37398238 TGGGAGGCACCCCCCCAGTAGGG + Intronic
1189049889 X:37633835-37633857 TGGGAGGCACCCCCCCAGCAGGG - Intronic
1190807603 X:53853853-53853875 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1191205402 X:57828101-57828123 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
1192755098 X:74039343-74039365 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1194417164 X:93628054-93628076 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
1194884136 X:99292045-99292067 TTGCTAACACCCACACAGCAGGG - Intergenic
1194982033 X:100450615-100450637 ATGGAAACACCCAGACAGCAGGG + Intergenic
1195088923 X:101440383-101440405 TGGGAGGCACCCCCCCAGCAGGG - Intronic
1195249100 X:103025867-103025889 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1195983722 X:110606557-110606579 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1195985100 X:110621312-110621334 TTGGATCTAACCACCCAGCAGGG + Intergenic
1196551514 X:117032128-117032150 TTGCAGACACAGACCCAGCCTGG - Intergenic
1197055421 X:122113367-122113389 TTGGATCTAGCCACCCAGCAGGG + Intergenic
1197754165 X:129983230-129983252 ATGGAGACCCCCGCCCAGCCGGG - Intronic
1199150618 X:144481133-144481155 TGGGAGACACCCATATAGCAGGG + Intergenic
1200574132 Y:4867087-4867109 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
1200583103 Y:4973970-4973992 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1200827218 Y:7657972-7657994 GTGGACACGCCCACCCAACAGGG + Intergenic
1200954529 Y:8930416-8930438 GTGGACACACCCACCCCTCAGGG - Intergenic
1200958364 Y:8973080-8973102 ATGGAGACGCCCACCCCTCAGGG - Intergenic
1201683694 Y:16678173-16678195 TTGAACACAGCCACCCACCAGGG - Intergenic
1202026476 Y:20528920-20528942 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
1202092585 Y:21209201-21209223 TTGGAGACTCTCACCCAGTTGGG - Intergenic
1202232657 Y:22671811-22671833 GTGGACACACCCACCCCTCAGGG - Intergenic
1202310499 Y:23524347-23524369 GTGGACACACCCACCCCTCAGGG + Intergenic
1202374601 Y:24222609-24222631 TAGGAGGCACCCCCCCAGTAGGG + Intergenic
1202496179 Y:25447511-25447533 TAGGAGGCACCCCCCCAGTAGGG - Intergenic
1202560303 Y:26146247-26146269 GTGGACACACCCACCCCTCAGGG - Intergenic