ID: 971761060

View in Genome Browser
Species Human (GRCh38)
Location 4:30765875-30765897
Sequence GAGGTTTACTAGAAGGCAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971761052_971761060 -4 Left 971761052 4:30765856-30765878 CCTCCCCCACCTGTCATTAGAGG 0: 1
1: 0
2: 3
3: 11
4: 178
Right 971761060 4:30765875-30765897 GAGGTTTACTAGAAGGCAGTCGG 0: 1
1: 0
2: 0
3: 15
4: 157
971761056_971761060 -9 Left 971761056 4:30765861-30765883 CCCACCTGTCATTAGAGGTTTAC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 971761060 4:30765875-30765897 GAGGTTTACTAGAAGGCAGTCGG 0: 1
1: 0
2: 0
3: 15
4: 157
971761055_971761060 -8 Left 971761055 4:30765860-30765882 CCCCACCTGTCATTAGAGGTTTA 0: 1
1: 0
2: 1
3: 12
4: 118
Right 971761060 4:30765875-30765897 GAGGTTTACTAGAAGGCAGTCGG 0: 1
1: 0
2: 0
3: 15
4: 157
971761054_971761060 -7 Left 971761054 4:30765859-30765881 CCCCCACCTGTCATTAGAGGTTT 0: 1
1: 0
2: 0
3: 6
4: 100
Right 971761060 4:30765875-30765897 GAGGTTTACTAGAAGGCAGTCGG 0: 1
1: 0
2: 0
3: 15
4: 157
971761057_971761060 -10 Left 971761057 4:30765862-30765884 CCACCTGTCATTAGAGGTTTACT 0: 1
1: 0
2: 2
3: 3
4: 88
Right 971761060 4:30765875-30765897 GAGGTTTACTAGAAGGCAGTCGG 0: 1
1: 0
2: 0
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971761060 Original CRISPR GAGGTTTACTAGAAGGCAGT CGG Intronic
902641658 1:17770388-17770410 CAGGTTTATTTGAAGCCAGTGGG + Intronic
902954303 1:19914459-19914481 GAGGTTCACTAGATGTCAGATGG - Intergenic
903346257 1:22686001-22686023 CAGGTTTGAGAGAAGGCAGTGGG - Intergenic
903575541 1:24337568-24337590 GAAGTCTCCTAGAGGGCAGTGGG - Intronic
904107347 1:28097059-28097081 AAGGTTCACTAGAATGAAGTAGG - Intergenic
904154772 1:28473765-28473787 GAGGTATATGAGTAGGCAGTGGG - Exonic
904628378 1:31822387-31822409 GAGGTTTAATACAGGGCACTGGG + Intergenic
904750759 1:32740544-32740566 CAGGATTACTAGAGTGCAGTGGG - Intergenic
907975839 1:59430704-59430726 GAGGTTTACCTGAATACAGTTGG + Intronic
909841535 1:80333626-80333648 GAAGGTTACTAGAAAGCTGTGGG - Intergenic
911189839 1:94936857-94936879 GAGGTATTATAAAAGGCAGTGGG - Intergenic
912510546 1:110187038-110187060 AAGATTTTCTAGAAGACAGTGGG + Intronic
915710762 1:157896000-157896022 GAGGTTTACAAGAGGGAAGTGGG - Intronic
916374328 1:164135603-164135625 GTGGTTTAATAAAAGGCAATTGG - Intergenic
918507810 1:185277111-185277133 CTGGCTTAATAGAAGGCAGTGGG + Intronic
918918929 1:190679840-190679862 GAGATTTCCTAGAGAGCAGTGGG - Intergenic
920746799 1:208636574-208636596 AAGGATTACTAGAAGCCAGTTGG + Intergenic
923920249 1:238556009-238556031 GACGTTTACCAGATAGCAGTTGG + Intergenic
923995377 1:239488373-239488395 GAGATTTACTATAATTCAGTTGG - Intronic
1064573348 10:16719062-16719084 GAGGATTGCTTGAAGGCAGGAGG + Intronic
1066549982 10:36545491-36545513 AAGGATTACTAGAAGCCAGGAGG + Intergenic
1066700223 10:38119936-38119958 GAGGATTAGTAGAAGAGAGTGGG + Exonic
1066991467 10:42518288-42518310 GAGGATTAGTAGAAGAGAGTGGG - Intergenic
1067492640 10:46726266-46726288 GAGGTATGATAGAAGACAGTAGG + Intergenic
1074430866 10:113393396-113393418 GAGATTTACAAGAAGTGAGTGGG + Intergenic
1074811543 10:117110231-117110253 GAGGATTACAATAAGCCAGTTGG - Intronic
1079943189 11:26708045-26708067 GAGGCTGACTTGAAGGCAGGTGG - Intronic
1080881300 11:36323249-36323271 GAGGTAGACTAGTAGGAAGTGGG + Intronic
1082824183 11:57566278-57566300 GTGATTTCCTAGTAGGCAGTAGG - Intronic
1084756766 11:71244630-71244652 GAGGTTTAATGGAAGACAGCTGG - Intronic
1085922071 11:80969254-80969276 GAGTTTTACATGAAGGCATTGGG + Intergenic
1087329643 11:96764345-96764367 AAGGTTTACTATAAAGGAGTAGG - Intergenic
1087586223 11:100125324-100125346 GAGGATTACTAGAGGGAAGTAGG - Intronic
1087943437 11:104129011-104129033 GATGTTTACTATAAGGCCGGTGG - Intronic
1089212991 11:116819138-116819160 GAGGTTTACTGGATGGCTTTAGG - Intergenic
1092117177 12:6017993-6018015 GAGGTTACCTTGAAGGCAGAGGG + Intronic
1093518278 12:20016971-20016993 GAGGCTTACTAGAAAGGAATTGG - Intergenic
1094444375 12:30513883-30513905 GAGGATTACTTGAAGCCAGAAGG - Intergenic
1095122168 12:38432587-38432609 GAGGTGGACAAGAAGACAGTGGG - Intergenic
1095984180 12:47988718-47988740 GAGGATTACTAGAGGCCAGTGGG - Intronic
1096417158 12:51424615-51424637 GAGATTTTCTAGCAAGCAGTTGG + Intronic
1096745528 12:53724577-53724599 GAGGTTTGAAAGAAGGTAGTGGG - Intronic
1097902581 12:64888084-64888106 GTGGTTTAATAGAAGACAGCTGG - Intergenic
1099136504 12:78910379-78910401 CAGGTTTAGTACAAGGCAGTAGG - Intronic
1099455334 12:82856322-82856344 GAAGTTTATTAGAATGCAGTAGG + Intronic
1101912472 12:108870529-108870551 GAGATTTACTAGAACCCAGGAGG + Intronic
1110192371 13:72745212-72745234 GAAGTATACTAAAAAGCAGTTGG + Intronic
1112994574 13:105557363-105557385 GAGGCTGAATAGAAGGCATTGGG + Intergenic
1113345223 13:109470920-109470942 GAGGTTTATTATGAGGCATTTGG - Intergenic
1117122560 14:52584044-52584066 GAGGAATACTAGAATGGAGTGGG - Intronic
1117628472 14:57664950-57664972 GAGCTTTCCAAGAAGGCAGGTGG + Intronic
1120176714 14:81302056-81302078 GTGGTTTATTAGAAGGCTGGAGG + Intronic
1121310549 14:92933104-92933126 GACGTTGTCCAGAAGGCAGTAGG + Intronic
1121679707 14:95783261-95783283 GAGCTATACTGGAAGGCAATAGG + Intergenic
1123956049 15:25335782-25335804 GAGGTTGACTAGAGGGAACTGGG + Intronic
1130688111 15:86056885-86056907 GATGTTGACAAAAAGGCAGTTGG + Intergenic
1130966240 15:88699949-88699971 GAGCTGAACTAGAAGGCAGAGGG + Intergenic
1135195588 16:20391768-20391790 GAGGTTAAAAAGAAGGCAGTGGG + Intronic
1138118624 16:54380283-54380305 GAAGTTAACTAGAGGGAAGTGGG + Intergenic
1138195895 16:55051885-55051907 GAGGGTTACCACAAGGCACTGGG - Intergenic
1138691778 16:58775518-58775540 GAGGTTTACTTGAGCCCAGTAGG - Intergenic
1139819412 16:69708874-69708896 GAGGCTGACAAGTAGGCAGTTGG - Intronic
1141297180 16:82781018-82781040 GAGGTTGCCTGAAAGGCAGTGGG + Intronic
1148925407 17:51080552-51080574 GAAGTTTTCTAGTAGGCAGTTGG - Intronic
1153282858 18:3430287-3430309 CTGGTTTAATAGAAGACAGTTGG - Intronic
1153834128 18:8949246-8949268 GAGATTTCCGAGAAGGCAGCAGG + Intergenic
1157447296 18:47755100-47755122 GAGGTTTGCTAGGAAGCACTTGG - Intergenic
1158966625 18:62627796-62627818 GAGGATTGCTTGAAGGCAGGAGG - Intergenic
1161274454 19:3407863-3407885 GAGGTTTCCTAGGAGGGAGAGGG + Intronic
1162742189 19:12779578-12779600 GAGGATTACTTGAAGTCAGGAGG - Intronic
1163775485 19:19214953-19214975 GAGGTTTACAAGTTGGTAGTTGG + Intronic
1163798181 19:19349087-19349109 CAGGTTTACAAAACGGCAGTGGG - Intronic
1164236690 19:23343809-23343831 GAGGTCTGATAGAAGTCAGTGGG - Intronic
925696815 2:6589316-6589338 GGGATTTATTAGAAGGCATTGGG + Intergenic
925851149 2:8083465-8083487 AAGGTTTAATACAAGGAAGTGGG + Intergenic
927246405 2:20960213-20960235 GTGGTTCATTAGAAGGCAGCTGG + Intergenic
930102736 2:47615797-47615819 GAGATTTAGTAGATGGGAGTGGG + Intergenic
931636083 2:64341739-64341761 GAACTTTACTGGAAGGCAGTTGG - Intergenic
931954992 2:67413025-67413047 GAGGTCTAAGAGAAGGCAGGAGG - Intergenic
932543118 2:72677972-72677994 GAGGATTGCTAGATTGCAGTAGG + Intronic
934576692 2:95406202-95406224 GAGGTTTTCTATAAGACACTTGG + Intronic
934638914 2:96014370-96014392 GAGGTTTTCTATAAGACACTTGG + Intergenic
934794737 2:97091041-97091063 GAGGTTTTCTATAAGACACTTGG - Intronic
935536282 2:104298196-104298218 GAGGTTTAAGAGGAAGCAGTTGG - Intergenic
936236758 2:110748743-110748765 GGTGTTTACTAGAAGGCAGATGG + Intronic
936875777 2:117187685-117187707 GAGGTTGACTGGAAGGCTGAAGG + Intergenic
943182970 2:184567327-184567349 AAAGTTTTCTAGAAGGCAGTAGG - Intergenic
943545165 2:189267134-189267156 GTGGTTTACTAAAAGTCATTTGG - Intergenic
944305363 2:198172870-198172892 CAGGTGTACTGGAAAGCAGTCGG + Intronic
946330047 2:219003884-219003906 GAAGGTTCCTAGGAGGCAGTGGG - Intronic
948422751 2:237870675-237870697 GAGTTTTACTGAATGGCAGTCGG + Intronic
949075925 2:242057852-242057874 GAGGCTTCCTAGAGGGCAGGGGG + Intergenic
1170666586 20:18391948-18391970 AATGTGTACTAGAATGCAGTAGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1171149853 20:22818120-22818142 GATGGATACTAGAAGTCAGTCGG + Intergenic
1172393255 20:34580925-34580947 AAAGGTTACTAGAAGGCAGAGGG - Intronic
1178334903 21:31733694-31733716 GAGGATGTCTAGGAGGCAGTTGG + Intergenic
1179082378 21:38183749-38183771 AAGGTTCAGTAGAAGGAAGTGGG + Intronic
1179148353 21:38788737-38788759 CTGGTTTAATAGAAGGCAGCTGG - Intergenic
1181507968 22:23374467-23374489 CAGGTTTAGTGGAAGGGAGTTGG - Intergenic
953718443 3:45335379-45335401 CAGGCATACTAGAAGGCAGGCGG + Intergenic
954402601 3:50326946-50326968 GGGGTCTACTAGAAGAAAGTGGG + Intronic
955107891 3:55917189-55917211 CTGATTTACTAGAAGCCAGTGGG - Intronic
955193583 3:56784533-56784555 AAGGTTTCCAAGAAGTCAGTAGG - Intronic
956519061 3:70083610-70083632 GAGGTCTTCTTCAAGGCAGTAGG + Intergenic
957342482 3:78918769-78918791 GAGGTTTCCTAGAAGTATGTGGG - Intronic
957610984 3:82466405-82466427 GAGGTTTAGTTGAAGTCATTAGG - Intergenic
959411211 3:106024683-106024705 TAGCTTTACAACAAGGCAGTAGG + Intergenic
963150323 3:142039474-142039496 GAGGTTTACTTGAACCCAGGAGG - Intronic
965966270 3:174494236-174494258 AGGGTTTACTTGAATGCAGTAGG + Intronic
966739992 3:183223697-183223719 CAAGTTCACTAGAAGACAGTGGG + Intronic
967695399 3:192525563-192525585 GAGGCTAAATTGAAGGCAGTTGG - Intronic
969218992 4:5747101-5747123 GGGGTTTACTGGGAGGCAATGGG + Intronic
971761060 4:30765875-30765897 GAGGTTTACTAGAAGGCAGTCGG + Intronic
972459393 4:39286611-39286633 GAGGTATACTGTAAGGCTGTAGG + Intergenic
973706885 4:53589785-53589807 CAGATTGACTAGAATGCAGTTGG - Intronic
981225316 4:142287549-142287571 GAGATTTAGAAGAAGGCAGAGGG - Intronic
982253070 4:153426514-153426536 GAGGTTTTCCAGAAAGCATTTGG - Intergenic
982795235 4:159636472-159636494 GAGACTTACTATAAGGCATTGGG + Intergenic
986300918 5:6477530-6477552 ATGGTTGACTAGAAGTCAGTGGG + Intronic
987277932 5:16381639-16381661 TTGGTTTAATAGAAGGCAGCTGG - Intergenic
987419515 5:17702289-17702311 GAGGCTTACTTGAAGGCAGAAGG + Intergenic
988681207 5:33485834-33485856 GAGTTTTACTAGAAGGAAATCGG - Intergenic
989344114 5:40409922-40409944 CAGCTTTACTCGAAGGCACTAGG - Intergenic
990938434 5:61175234-61175256 GAGGCTTATTAAAAGGCCGTAGG + Intergenic
991081651 5:62607441-62607463 GAGGTTTTCTAGAAGCAAATGGG - Intronic
991274768 5:64831848-64831870 CTGGTTTAATAGAAGGCAGCTGG + Intronic
994286087 5:97969866-97969888 GAGGAGAACTTGAAGGCAGTAGG - Intergenic
994603417 5:101937002-101937024 GAGGATTACTAGAGGGCGGAGGG - Intergenic
995731721 5:115250796-115250818 GGGGAGTACTAGAAGGAAGTGGG - Intronic
995763949 5:115595624-115595646 GAGTTTTTCTTGAAGGCATTAGG - Intronic
997603934 5:135159672-135159694 AAGGTTTACTAGAAGGAGGGTGG - Intronic
1000147536 5:158468068-158468090 GAGGATTACTTGAACGCAGGAGG - Intergenic
1001784892 5:174403563-174403585 GATCTCTACCAGAAGGCAGTGGG - Intergenic
1010328040 6:74587858-74587880 GACCTTTACTTCAAGGCAGTGGG - Intergenic
1012877634 6:104746790-104746812 TAGGTTTGCTAAAAGGGAGTGGG + Intronic
1014963887 6:127722423-127722445 GAGGGTTAGTGGAGGGCAGTTGG - Intronic
1015268944 6:131319395-131319417 GAGGACTACTAGAAGGGAGAAGG + Intergenic
1015691031 6:135923029-135923051 GAGGTTTTCCAGAAGGTGGTTGG - Intronic
1017476021 6:154794009-154794031 GAGGATCACTAGAAGCCAGGAGG - Intronic
1019422148 7:955434-955456 GTGGTTGCCTGGAAGGCAGTGGG - Intronic
1020052228 7:5089254-5089276 GAGGTTTTCTTGCATGCAGTTGG - Intergenic
1020983274 7:15098660-15098682 GAAGTTTACTAGAAGCCTTTGGG - Intergenic
1021377595 7:19927125-19927147 CAGGTTTACTAGAGGCAAGTAGG + Intergenic
1021656679 7:22880517-22880539 GAGGTAGGGTAGAAGGCAGTGGG - Intergenic
1021734360 7:23628602-23628624 GAGGTGTTAGAGAAGGCAGTAGG + Intronic
1026639380 7:72110772-72110794 GAGGCTTATTAGAAGGAAATGGG + Intronic
1027236464 7:76301197-76301219 GAGGATTACTTGAAGCCAGAAGG - Intergenic
1029899843 7:104027235-104027257 CTGGCTTACTAGAAGGCAGCTGG + Intergenic
1031129086 7:117810454-117810476 CATGTTTTCTAGAAGGCACTAGG + Intronic
1032415707 7:131733782-131733804 GAGGTAAACTTGCAGGCAGTGGG + Intergenic
1033104045 7:138503098-138503120 GATGTTCACTAGAAATCAGTGGG - Intronic
1037328354 8:17718124-17718146 GGGGTTTACTGGAAAGCAGTGGG - Intronic
1038472756 8:27839058-27839080 GAGTTTTACAAGAAGGCCCTGGG + Intergenic
1039202916 8:35116594-35116616 GAGGGCTACTAGAGGGCAGAGGG - Intergenic
1039283960 8:36019320-36019342 GAAGGTGACTAGAAGGCAATTGG - Intergenic
1044176935 8:89137536-89137558 GAGGTTTATTATAAGGAAGGGGG - Intergenic
1047109419 8:121772403-121772425 GAGGTTTTCTAAGAAGCAGTGGG - Intergenic
1048398335 8:134036904-134036926 GAGGTTTTATAGGAGGCACTGGG + Intergenic
1051333605 9:16047000-16047022 CATGCTTACTAGAAAGCAGTAGG - Intronic
1057585257 9:96323164-96323186 GAGGTCTCCTAGAATGCACTGGG - Intronic
1057862998 9:98656875-98656897 GAGGTTTATTAACAGGCAGCTGG + Intronic
1059497075 9:114718812-114718834 GAAATTTATTAGAAGGCAGGGGG - Intergenic
1186544119 X:10431180-10431202 TGGCTTTACTTGAAGGCAGTGGG + Intergenic
1186977146 X:14919676-14919698 GTCGTTTACTAGAAAGCAATAGG + Exonic
1188043567 X:25399282-25399304 GAGGACTACTAGAAGGCAGAGGG + Intergenic
1195413992 X:104600670-104600692 GGGGACTACTAGAAGGCAGAGGG - Intronic
1196458782 X:115908694-115908716 GAGGATGAATAGAAGGCAGAGGG + Intergenic
1196462766 X:115947121-115947143 GAGGATGAATAGAAGGCAGAGGG + Intergenic
1197176625 X:123493128-123493150 GAGGTTGAGTATATGGCAGTAGG - Intergenic
1200914844 Y:8562482-8562504 GAGTTTTACTGTAACGCAGTGGG + Intergenic
1202297233 Y:23372355-23372377 TTGGTTTAATAGAAGACAGTGGG - Intergenic
1202573574 Y:26298242-26298264 TTGGTTTAATAGAAGACAGTGGG + Intergenic