ID: 971761398

View in Genome Browser
Species Human (GRCh38)
Location 4:30770768-30770790
Sequence CAGTTATAACAAATGGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 278}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971761398_971761401 6 Left 971761398 4:30770768-30770790 CCGTGTTCCATTTGTTATAACTG 0: 1
1: 0
2: 1
3: 28
4: 278
Right 971761401 4:30770797-30770819 CACAAGAACCACATTTTGAAGGG 0: 1
1: 0
2: 0
3: 29
4: 255
971761398_971761400 5 Left 971761398 4:30770768-30770790 CCGTGTTCCATTTGTTATAACTG 0: 1
1: 0
2: 1
3: 28
4: 278
Right 971761400 4:30770796-30770818 ACACAAGAACCACATTTTGAAGG 0: 1
1: 0
2: 2
3: 28
4: 259
971761398_971761402 7 Left 971761398 4:30770768-30770790 CCGTGTTCCATTTGTTATAACTG 0: 1
1: 0
2: 1
3: 28
4: 278
Right 971761402 4:30770798-30770820 ACAAGAACCACATTTTGAAGGGG 0: 1
1: 0
2: 2
3: 19
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971761398 Original CRISPR CAGTTATAACAAATGGAACA CGG (reversed) Intronic
902943813 1:19819410-19819432 CAGTAAGCACAAATAGAACATGG - Intergenic
905341744 1:37282854-37282876 CAGTTATTTAAAATGGAAAAAGG + Intergenic
906799338 1:48722238-48722260 CAGTAAGATGAAATGGAACAGGG + Intronic
906866048 1:49421357-49421379 CAGTTGTAACAAATGCTACGGGG + Intronic
907467158 1:54646123-54646145 CAGTGATAACAAGTGGCCCAGGG - Intronic
907727269 1:57031354-57031376 CAGTATTATCAGATGGAACATGG - Intronic
908074958 1:60506638-60506660 CAATTATAGCAAATGGAAAGAGG + Intergenic
909177169 1:72375704-72375726 AAATTAAAACAAATGGAATATGG - Intergenic
909300518 1:74007596-74007618 CAGTTATAAGAAATGTAATTTGG - Intergenic
909794931 1:79721492-79721514 CCAATATAACAAATGAAACAAGG + Intergenic
910071454 1:83219105-83219127 CAGTTGTAACAGGTGGAAAATGG - Intergenic
911096338 1:94058128-94058150 CAGATAAAACAAATGGCAAAGGG + Intronic
911315834 1:96355696-96355718 CAGTGATCCCAAATAGAACAGGG + Intergenic
911604771 1:99891480-99891502 CAGTTATAATAAATGGAAATCGG + Intronic
911627405 1:100140548-100140570 CAGTTTTAACAAATGAACAAAGG - Intronic
912663669 1:111559686-111559708 CAGTGATAGCAAAAGGAACATGG - Intronic
913056983 1:115171316-115171338 CACTTCTAATAAATAGAACATGG - Intergenic
915886356 1:159726163-159726185 CAGTTTTGACAAATGTACCATGG + Intergenic
916671250 1:167022915-167022937 CAATTAAAAAAAAAGGAACATGG - Intergenic
918477521 1:184941096-184941118 CAGTTTTGACAAATGGAAGAAGG + Intronic
919216284 1:194559988-194560010 CACTTCTAACAAATAAAACATGG + Intergenic
919406673 1:197193539-197193561 CTGTTATAACAAATCAAACTAGG + Intronic
919562321 1:199137300-199137322 CAGTTATAGTAACTGGAACAGGG - Intergenic
919613132 1:199771959-199771981 CATTTATAATAAAAGGAAGAAGG + Intergenic
921257332 1:213354499-213354521 CTGTTATAAGAAATGGAAAATGG - Intergenic
922704635 1:227782740-227782762 AAGCTCTAACAGATGGAACAAGG + Intergenic
923221396 1:231897445-231897467 CAGTTATCATTTATGGAACAAGG + Intronic
924685051 1:246280161-246280183 CAGTTATAAGAAACTGAGCATGG - Intronic
1063949035 10:11205301-11205323 CTTTTATAACAAATGCAATACGG - Intronic
1066335379 10:34472085-34472107 TAGTAATAACAAATTTAACATGG + Intronic
1067244016 10:44521150-44521172 TAGTTTTGACAAATGGACCATGG - Intergenic
1068780354 10:60913156-60913178 CAGTTAGGACTATTGGAACATGG + Intronic
1071414488 10:85428491-85428513 CAATGAGAACACATGGAACATGG - Intergenic
1071675076 10:87647828-87647850 TATTTATAACCAATGGAATATGG - Intergenic
1072871878 10:99128628-99128650 CAGTGAGAACACCTGGAACAGGG + Intronic
1073576451 10:104630186-104630208 CAGTTATAAGAAATACAAAAAGG - Intergenic
1073589486 10:104742816-104742838 CAGTTCCAACCAATGGAACATGG - Intronic
1074735085 10:116422695-116422717 CAGTTCTAATAACAGGAACAGGG + Intergenic
1074735393 10:116425910-116425932 CAGTTCTAATAACAGGAACAGGG + Intergenic
1074909441 10:117894400-117894422 CAGGTATATCAACTGGGACAGGG - Intergenic
1075155051 10:119968686-119968708 CTGTTTTAACAAATGTGACACGG - Intergenic
1076466804 10:130688559-130688581 CATTTATGACAAATAGAATATGG + Intergenic
1078870419 11:15339094-15339116 CTATTCTAACAAATGGAGCATGG - Intergenic
1078930941 11:15911648-15911670 CACTTCTAACAGATAGAACATGG + Intergenic
1078963555 11:16308877-16308899 CAGATACAACAAAAGGAAAAAGG + Intronic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1079930098 11:26547944-26547966 AGGTTATAGCAAATGAAACAAGG - Intronic
1080437549 11:32259933-32259955 CACTTGTAACAAATAGAATATGG - Intergenic
1080834097 11:35923874-35923896 CAGTAAGAAGAAATGGAAAAAGG - Intergenic
1080909668 11:36582981-36583003 CAGTTATTTCAAGTGTAACATGG - Intronic
1081264001 11:40996720-40996742 CACTTATGACAAATGGCAAAGGG + Intronic
1082865462 11:57896182-57896204 CACTTGTAACAAATAGAACATGG + Intergenic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1085927883 11:81043898-81043920 CATTTATAAAAATTGGAATAAGG + Intergenic
1086852991 11:91833068-91833090 CAGCTGTAACACATGGTACAGGG + Intergenic
1087145279 11:94804607-94804629 CAGTTATAACAAATTCAAATAGG - Intronic
1087626741 11:100604211-100604233 CAGTGAGAAGAAATGGATCAGGG - Intergenic
1088174419 11:107034992-107035014 TAGTTTTAACAAATGCACCATGG + Intergenic
1088764992 11:112966102-112966124 CAGTTATAACATATAGACTAAGG + Intronic
1089630976 11:119783966-119783988 CAGTTTTCACAAATAGAATATGG + Intergenic
1090825840 11:130385183-130385205 CAATAATGACAAATGGTACAAGG - Intergenic
1091946098 12:4544476-4544498 GAATATTAACAAATGGAACATGG + Intronic
1093645362 12:21579858-21579880 CTTTTATAGCAAATGGAATATGG - Intronic
1094793682 12:33945278-33945300 GAGTGATAACAGATGGATCAGGG + Intergenic
1096430031 12:51535354-51535376 CAGTTTTAACAAATGTAGCAGGG - Intergenic
1096456667 12:51793047-51793069 GATTTAAAACAAATGGATCATGG - Intronic
1097510039 12:60528242-60528264 CAATTATAATAAAAGCAACATGG - Intergenic
1098098124 12:66982414-66982436 CACCTATAACAAATAGAACAGGG + Intergenic
1098172219 12:67758486-67758508 CTGTTATAAGCAATGGAACATGG + Intergenic
1100023855 12:90103832-90103854 CAATTATATTAAATTGAACAAGG - Intergenic
1102653549 12:114461172-114461194 GAGTGATGACCAATGGAACATGG + Intergenic
1103225146 12:119280925-119280947 CAGTTAAAACCAACAGAACAGGG + Intergenic
1105611533 13:21973729-21973751 CACTTTTACCAAATGGAATATGG + Intergenic
1105955049 13:25273886-25273908 CAGTTATAGAATATGTAACATGG - Intronic
1107920735 13:45204318-45204340 CAGGAATAACAAATGAAACACGG - Intronic
1108818608 13:54318974-54318996 CTGATATAACAAGTAGAACATGG - Intergenic
1108826512 13:54418405-54418427 AAGTTAAAACAAATGCCACATGG + Intergenic
1109333898 13:60968212-60968234 AAATTATAATAAATGGAATAAGG - Intergenic
1111224129 13:85247072-85247094 CATTTAAAACAAATGGATCTTGG - Intergenic
1111422371 13:88030029-88030051 CAGGCACAACAAAAGGAACATGG - Intergenic
1112171317 13:96975706-96975728 CAGTTAAAATAAATGGAAAGGGG + Intergenic
1112989164 13:105489799-105489821 GACTTCTAACCAATGGAACATGG + Intronic
1113993341 14:16045988-16046010 CAGTGAAAACCAATGAAACAGGG - Intergenic
1114334601 14:21675278-21675300 CTGTTAAAACAAATGAAATATGG + Intergenic
1115255520 14:31397210-31397232 CATTTTTAAAAAATGTAACAAGG - Intronic
1117815543 14:59593839-59593861 GATTTTTCACAAATGGAACATGG - Intergenic
1118652250 14:67909279-67909301 GAGTTATAACAAATGAAAAGTGG + Intronic
1120020144 14:79520488-79520510 CAATGAGAACACATGGAACAGGG - Intronic
1123166917 14:106334475-106334497 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123169532 14:106359186-106359208 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1124219890 15:27842021-27842043 CAATTATCAGAAATGAAACAAGG + Intronic
1126545819 15:49872902-49872924 TAGTTTTAACAAATGCACCATGG + Intronic
1126645115 15:50868029-50868051 CAGTTACAGCAAAATGAACAAGG - Intergenic
1127853602 15:62936462-62936484 CAGTTAATACAAATGGAATATGG - Intergenic
1130360995 15:83185814-83185836 TACTTATAATGAATGGAACATGG + Intronic
1131650894 15:94398418-94398440 CAGTTTTAACAAATGTATTATGG - Intronic
1136912704 16:34157707-34157729 CAGTGAAAACCAATGAAACAGGG - Intergenic
1139515399 16:67449704-67449726 CAGCTTTAGCAAATGGAACTGGG - Intronic
1140232112 16:73125955-73125977 CAGTAATAAGAAATGGAGCCAGG + Intergenic
1140342783 16:74181774-74181796 CACTTCTAACTAATAGAACATGG + Intergenic
1140492865 16:75354566-75354588 CAGTTCTGACAAATGCACCATGG + Intronic
1141596594 16:85100693-85100715 CACTTCTAACAAATGGAATATGG + Intronic
1144130290 17:12240124-12240146 CAGTTTTAACAAATGTACCACGG - Intergenic
1147122925 17:38346477-38346499 CCATTTTAACAAATGAAACACGG + Intergenic
1149438929 17:56658709-56658731 CATTTCTGACCAATGGAACATGG + Intergenic
1151023612 17:70650374-70650396 CACTTATAATAATTGGTACATGG - Intergenic
1151712685 17:75815583-75815605 CAGACATCACTAATGGAACATGG + Intronic
1153036435 18:767451-767473 GAGTTTTAAAAAATTGAACATGG - Intronic
1155424126 18:25688204-25688226 CATTTATAACAAATTTAACATGG - Intergenic
1155559067 18:27055789-27055811 ATGATATAACAAAAGGAACACGG + Intronic
1156779738 18:40837167-40837189 CTCTCATAAAAAATGGAACAGGG - Intergenic
1157550309 18:48576648-48576670 CCGTAATACCAAATGAAACAAGG + Intronic
1159647754 18:70939879-70939901 CAGTCTTATCAAATGGAATACGG + Intergenic
1163481111 19:17556607-17556629 CAGTTTTCTCAAATGGAAAATGG + Intronic
1163962920 19:20714112-20714134 CAATGAGAACACATGGAACAGGG + Intronic
1165252314 19:34549862-34549884 CAGTTATAAAAGATGTAACATGG - Intergenic
1168372424 19:55847622-55847644 TAGTTATGACAAATGTACCATGG - Intronic
925315084 2:2916020-2916042 CAATTTTAACAAATGAAAAAAGG - Intergenic
925467654 2:4123336-4123358 CAGTTATAGCCAATGGCCCAGGG - Intergenic
925833754 2:7922782-7922804 TAGTTTTGACAAATGGACCACGG + Intergenic
927477586 2:23425807-23425829 CAGTGCTCACAAATGGTACAAGG - Intronic
928536787 2:32248924-32248946 TAGTTATGGCAGATGGAACAGGG - Intronic
929304350 2:40343872-40343894 CTATTATAAAAAATGGAAAAGGG - Intronic
929404542 2:41626396-41626418 CAGTTTTAACAAATTGAATGTGG - Intergenic
930293485 2:49525342-49525364 CAGATAAAACAAATTGAAAAGGG + Intergenic
930968088 2:57356804-57356826 TATTTATAACAAATGAAACTGGG - Intergenic
931014493 2:57960816-57960838 AATTTATAACAAGTGTAACAGGG + Intronic
931865823 2:66410114-66410136 CAGAAATAACAAAAAGAACATGG - Intergenic
932300976 2:70666869-70666891 GAGTCATAGCAAATGGAAAATGG + Intronic
933818344 2:86087104-86087126 CAGTTTTGACAAATGCACCATGG + Intronic
935249404 2:101248439-101248461 CAGTTATAACTTAAGGAAAAAGG + Intronic
936524459 2:113233378-113233400 CAGTTATAAAAAAGGGTCCATGG + Intronic
936617681 2:114064917-114064939 CAGTTAAAACTAATGCAATAAGG + Intergenic
937215236 2:120308564-120308586 CACTTCTAACCAATGGAATACGG - Intergenic
937589589 2:123597172-123597194 CAGTTATTCCAAAAGGAAAAGGG - Intergenic
938538338 2:132264858-132264880 CAGTGAAAACCAATGAAACAGGG + Intergenic
939469695 2:142604963-142604985 CATTTATATGAAATGGAAGAAGG - Intergenic
940025754 2:149205467-149205489 AAGTTACAATAAATGGAAAAGGG - Intronic
940035107 2:149304454-149304476 AAGCTATAAGAAACGGAACATGG - Intergenic
940815490 2:158293170-158293192 CAGATATAATAAATGTAATATGG + Intronic
942585808 2:177475632-177475654 CAGTTATAAAAAAAGGAATGAGG - Intronic
943840860 2:192578780-192578802 CAGTTAAGAGAAAAGGAACAGGG - Intergenic
944593864 2:201244131-201244153 CAGTTACAATAAATAGACCATGG + Intronic
945542892 2:211110508-211110530 CAATTTTAGCAAACGGAACAAGG - Intergenic
946447268 2:219750983-219751005 CAGTTTTATCAAATAGAAAAGGG - Intergenic
946594092 2:221286756-221286778 CAGTTATTACATATGGAAACTGG + Intergenic
946672389 2:222119475-222119497 CAATGAGAACACATGGAACATGG - Intergenic
947672208 2:231944999-231945021 CAATTATAAGAACTGGAAAATGG - Intergenic
1169981081 20:11384521-11384543 CAGTTATAACAACTGGACTAGGG - Intergenic
1170065876 20:12310035-12310057 CAGTTATGGCAAAAGGATCAAGG - Intergenic
1170231048 20:14046910-14046932 AAGCTCTAACAAATGGAAAATGG + Intronic
1170841229 20:19926013-19926035 CACTTACAACAAATGAACCAGGG + Intronic
1171811680 20:29749870-29749892 CAGTGAAAACCAATGAAACAGGG + Intergenic
1171867238 20:30496655-30496677 CAGTGAAAACCAATGAAACAGGG + Intergenic
1171907991 20:30915851-30915873 CAGTGAAAACCAATGAAACAGGG - Intergenic
1174950137 20:55033749-55033771 CATTTATAACAATAGGAACAGGG - Intergenic
1175061261 20:56245584-56245606 CAGTTATAATAAATGTAACAAGG - Intergenic
1175760080 20:61556543-61556565 AATTGAGAACAAATGGAACAAGG + Intronic
1180313927 22:11261525-11261547 CAGTGAAAACCAATGAAACAGGG + Intergenic
1180677601 22:17598537-17598559 CAGTTATTACATTTGAAACATGG + Intronic
1183887075 22:40892932-40892954 ATATTATAACAGATGGAACATGG + Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
949180670 3:1126618-1126640 CAGTGATACAAAATTGAACAAGG - Intronic
949474311 3:4428652-4428674 CAGACATTAAAAATGGAACAGGG - Intronic
949969806 3:9395784-9395806 CAAGTACAACAAATGGAAAATGG + Intergenic
951523297 3:23629487-23629509 AAGTTATAGAAAATGGGACAAGG - Intergenic
951652506 3:24966342-24966364 CAATTTTAACAAATGAAAGAAGG + Intergenic
952544934 3:34408759-34408781 CAGTAATAACAAGTGGAAGCTGG - Intergenic
952778509 3:37070412-37070434 CAGTTGTAAGAAATTAAACAGGG - Intronic
955132200 3:56181682-56181704 CACTTCTAACAAATAGAATAAGG + Intronic
955271064 3:57499958-57499980 CAGTTTTAACCAATAGAACAAGG + Intronic
956577320 3:70766704-70766726 GAGTTCTAGCAAATGGAATAAGG + Intergenic
956844176 3:73167176-73167198 CACATGTAACAAATGGAACATGG - Intergenic
958992280 3:100860767-100860789 CGGTTATAACATGGGGAACATGG - Intronic
959030507 3:101294286-101294308 CAGTGAGAACACATGGAAAAAGG - Intronic
959176974 3:102925476-102925498 CATTAATAACAAAGTGAACAAGG - Intergenic
960147321 3:114217189-114217211 CAGTTATCCCAAATGCAAAATGG + Intergenic
960370696 3:116834494-116834516 CATTTAGAACAAATGTAAAATGG - Intronic
960506222 3:118497989-118498011 CAGTTTTTAAATATGGAACATGG + Intergenic
961172375 3:124806735-124806757 TAGTTATAAAAAATGGAATGAGG - Intronic
961588736 3:127958695-127958717 AAGCTGTAACAAATGGAACTTGG + Intronic
961594932 3:128008511-128008533 CTGTTAAAAAGAATGGAACAAGG + Intergenic
964197120 3:154077807-154077829 GATTCATAACAAATAGAACAGGG + Intergenic
965951070 3:174308811-174308833 CAGGAATAAAAAAAGGAACATGG + Intergenic
966457830 3:180137815-180137837 CAGAAATAACAAGTGGAAAAAGG + Intergenic
966817417 3:183900569-183900591 CACTTCTAACAAATAGAAAATGG + Intergenic
967128792 3:186451665-186451687 CATTTCTAACAAATAGAATAAGG - Intergenic
968941022 4:3637744-3637766 CAGAGAGAACAAATGAAACATGG + Intergenic
969244417 4:5923295-5923317 CAGTAATAACAACAAGAACAAGG + Intronic
970065399 4:12087966-12087988 GAGTTATAACAAATGCTAAAAGG - Intergenic
970775226 4:19666772-19666794 CATTTATACCAAAGGAAACAAGG - Intergenic
971761398 4:30770768-30770790 CAGTTATAACAAATGGAACACGG - Intronic
972532152 4:39971072-39971094 CAGTTTTCAAGAATGGAACAAGG - Intronic
974484569 4:62490507-62490529 TAGTTATAAGAAAAAGAACAAGG - Intergenic
974627149 4:64440461-64440483 CAGATATAGCAAAAGGAAGAAGG - Intergenic
975878727 4:78875954-78875976 CAATTCTAACAAATGAAATATGG - Intronic
977883409 4:102232898-102232920 TAGTTCTAACAGATGAAACATGG + Intergenic
978002066 4:103568070-103568092 CAGTCATCTCAAATGTAACATGG - Intergenic
979069830 4:116187961-116187983 CAGTGAAAACAAATGCATCATGG + Intergenic
979310215 4:119194073-119194095 AAGTTATAACCAATGAAAGAAGG + Exonic
979824151 4:125212055-125212077 CTGTTTTGACAAATAGAACACGG - Intergenic
980662777 4:135885954-135885976 CAGTTAAAACAAAAAGAACAAGG - Intergenic
980884701 4:138749527-138749549 CACTTCTAACAAATAGAATATGG - Intergenic
981103049 4:140851785-140851807 TAGTTATGACAAATGTACCATGG - Intergenic
981162389 4:141514141-141514163 CAGTTGTAACAAACGTAAGAGGG - Intergenic
982762245 4:159299253-159299275 CAGTTATAACAGAATGCACAAGG - Intronic
982905655 4:161066954-161066976 CAAATATAGCAAATGGAAGAAGG + Intergenic
984626652 4:182014924-182014946 CTTTTATAGCAAATGTAACAGGG - Intergenic
985838442 5:2288121-2288143 CAGTCATTAAAAATGAAACAAGG + Intergenic
986060535 5:4186094-4186116 CAGTTATAAGAAATGCAATCTGG + Intergenic
986418009 5:7547609-7547631 CATTGATAACACAGGGAACAAGG - Intronic
988112233 5:26836865-26836887 CAAAAATAACAAATGGAAAATGG + Intergenic
990032475 5:51278406-51278428 CAATGAGAACACATGGAACAGGG - Intergenic
990264288 5:54058999-54059021 ATGTTGTGACAAATGGAACAAGG - Intronic
991150862 5:63367568-63367590 CATTGAGAACAAATGTAACAAGG + Intergenic
994575410 5:101572383-101572405 CAGATAAAACAAATGTCACATGG - Intergenic
994861951 5:105208117-105208139 CAGCTATACCAAATGCAACTAGG + Intergenic
995033382 5:107505891-107505913 CAGTTTTCTCAAATGGAAAATGG - Intronic
995673274 5:114632463-114632485 CATTTTTAAAAAATAGAACATGG - Intergenic
996719760 5:126618576-126618598 GAGATACAACAAATGGAATATGG - Intronic
997074016 5:130651025-130651047 AAATTATAAAATATGGAACAAGG - Intergenic
998500534 5:142628657-142628679 CAGTTAGAAAAAAAGAAACAAGG - Intronic
998654532 5:144161946-144161968 TAGTGGTAACAAATTGAACAGGG - Intronic
999248013 5:150165689-150165711 CAGCCATAATAAATGGATCAGGG + Intergenic
1000046517 5:157526255-157526277 CAGTAATAACAGATGGAGAATGG + Intronic
1000356432 5:160400363-160400385 CATTTATTCCACATGGAACATGG - Intergenic
1000657392 5:163896723-163896745 CAGTCATTACAAAGGGTACATGG + Intergenic
1003528995 6:6921957-6921979 CAGTTCTAACAAATGGAAGGTGG + Intergenic
1003601739 6:7523937-7523959 AAGTTTTAACAAAGGGCACAGGG + Intergenic
1005154295 6:22786060-22786082 AAGTTATAATAAATGGTGCAAGG - Intergenic
1005221203 6:23590989-23591011 AAGTTGTAACAGATGGAACAGGG - Intergenic
1005607959 6:27494380-27494402 CAGGTAAAACAAATGAATCAGGG - Intergenic
1005771616 6:29078854-29078876 CAATGAGAACACATGGAACAGGG + Intergenic
1005804039 6:29457157-29457179 CAGTTTTAACAAATAGAATCTGG - Intergenic
1006715884 6:36120124-36120146 CAGTTATCACAACTGTAAAATGG + Intergenic
1007226086 6:40315737-40315759 CAGTTATAAGAAATTGTACACGG + Intergenic
1010338247 6:74715179-74715201 AATTTAAAACAAATGGAAGAGGG - Intergenic
1011155917 6:84331970-84331992 CAGTAATAACAAGTGCAAAAAGG - Intergenic
1012239321 6:96854234-96854256 CAGTGATGACTAATGGATCATGG - Intergenic
1012635549 6:101534922-101534944 CAGTTCTACCAAATGGCAAATGG - Intronic
1013784184 6:113760804-113760826 AAGTTTAAACTAATGGAACAGGG + Intergenic
1015577923 6:134692288-134692310 CAATTTAAAAAAATGGAACATGG - Intergenic
1016238772 6:141902650-141902672 CAATGATAACACATGGACCAGGG - Intergenic
1017312205 6:152987108-152987130 CAGTTACCACAACTGGAAGATGG - Intergenic
1017989579 6:159474295-159474317 TAGTTATTACAAATGTAAGAAGG + Intergenic
1018148968 6:160920792-160920814 CAACTATAACAAATGGGACCTGG - Intergenic
1018456046 6:163953236-163953258 CAATTGTCACAAATGAAACATGG - Intergenic
1020767621 7:12344382-12344404 CAGTTAGAACCAATGTAACCAGG + Exonic
1020865716 7:13559509-13559531 CAGTTTTGAAAAATGAAACATGG - Intergenic
1020903050 7:14029550-14029572 CAGTAATAACACATAAAACATGG - Intergenic
1020995018 7:15252380-15252402 TGTTTATAACAAATGGAATATGG + Intronic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1024445550 7:49473910-49473932 CAGTTATAACATATGAGACTGGG + Intergenic
1025985873 7:66451337-66451359 AAGTTGGAACAAATGGAACTTGG + Intergenic
1026345670 7:69472071-69472093 CAGCTGTAACAAATGTACCATGG + Intergenic
1027253532 7:76414896-76414918 CAGTTTTGACAAATGTACCATGG - Intronic
1027289163 7:76684056-76684078 CAGTTGTAACAGGTGGAAAATGG - Intergenic
1027591704 7:80126813-80126835 CAGTTAACACAAATGAAAAATGG + Intergenic
1028332611 7:89614249-89614271 TATTGATAACTAATGGAACAAGG - Intergenic
1028626590 7:92884453-92884475 CAATTATAAGAAATTGAAGAAGG + Intergenic
1029874106 7:103730600-103730622 AATTTATAACAAATGTAAAAAGG + Intronic
1030782050 7:113612952-113612974 CAGATTCAACAAATGAAACATGG + Intergenic
1031505389 7:122575935-122575957 TGGTTATAACAAATGTACCATGG - Intronic
1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG + Intergenic
1033970101 7:147028507-147028529 GAGGTATAGCTAATGGAACAAGG + Intronic
1034375039 7:150634839-150634861 CAATGAGAACACATGGAACAGGG - Intergenic
1035085057 7:156251165-156251187 CACATATAACAACTGGAAAACGG + Intergenic
1037198690 8:16223550-16223572 CAGTTAGAAGAAATGGGATAGGG + Intronic
1038915102 8:32012621-32012643 CATTTATAGCTAATTGAACATGG + Intronic
1041870167 8:62625136-62625158 AAGTTATAACAAATGCTAGAAGG - Intronic
1042701179 8:71616747-71616769 CAGTGTCAGCAAATGGAACAAGG + Intergenic
1043936398 8:86147666-86147688 CAGTTATGATAAAAGGAAAATGG + Intronic
1044184283 8:89233905-89233927 TATTTATAACAACAGGAACAGGG - Intergenic
1044671281 8:94683451-94683473 CAGTTGTAACAAATAATACATGG + Intronic
1045879196 8:107017912-107017934 AAGTCATAACAAATTGAACAAGG + Intergenic
1047365281 8:124205625-124205647 CATATCTAACAAATGGAACCAGG - Intergenic
1048830889 8:138476394-138476416 TAATTATAAGAAATGGACCACGG + Intronic
1050297877 9:4224603-4224625 CACCTCTAGCAAATGGAACAGGG + Intronic
1050452634 9:5799459-5799481 AAGTTATTTCAAATGGAGCACGG - Intronic
1050647026 9:7731308-7731330 CAGTAATAATAAATACAACAAGG + Intergenic
1052949836 9:34199528-34199550 CAGTTTTGACAAATGTATCATGG - Intronic
1055183620 9:73422333-73422355 AAGTTCTAACAAATGCAATAAGG + Intergenic
1055187945 9:73478647-73478669 GAGTTATGAGAGATGGAACAGGG - Intergenic
1055607365 9:77984802-77984824 CAGTTATAATAAGTGAATCAGGG - Intronic
1056241449 9:84651528-84651550 AATTTATCCCAAATGGAACATGG - Intergenic
1056329257 9:85508470-85508492 CTGAAATAACAGATGGAACAGGG + Intergenic
1057526297 9:95805497-95805519 CAGTCCTAACAAAAGCAACAAGG + Intergenic
1058220398 9:102292696-102292718 CATTTATCACATATGGATCAGGG + Intergenic
1058639099 9:107065741-107065763 CATTTGTAACCAATGGAACAGGG + Intergenic
1058794011 9:108479733-108479755 CAGTTATGACAAATGTACCATGG - Intergenic
1059037918 9:110778850-110778872 CAATTATAACAAATGTGAAAAGG - Intronic
1059990776 9:119863276-119863298 AAGGTATAACAAATGTAGCAAGG + Intergenic
1060777612 9:126387310-126387332 CAGTGATTAAAAATGAAACAAGG - Intronic
1186542903 X:10419128-10419150 CATTTCTAACCAATGGAATACGG + Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1192731276 X:73804794-73804816 CTGTTTTAAGAAATGGAAAAAGG + Intergenic
1195331552 X:103807246-103807268 CAGTTATAATAAGAGGAAAAAGG - Intergenic
1195979971 X:110567227-110567249 CACTTCTAACAAATAGAATATGG - Intergenic
1196096970 X:111810219-111810241 CACTTTTAACAAATAGAATATGG - Intronic
1196258790 X:113553858-113553880 CAATTATAAAAAATGAAACTGGG - Intergenic
1197111836 X:122784334-122784356 CAGTTATCAGACATGAAACATGG + Intergenic
1197432221 X:126380142-126380164 CAGTTATGAAAAATGGTTCATGG + Intergenic
1197657060 X:129127980-129128002 CAGTTAGAATAAATGAAACATGG + Intergenic
1198623190 X:138536659-138536681 CAGTCATAAAAAAAGGAAAAAGG + Intergenic
1198847679 X:140930558-140930580 CAATTATTGCAAATTGAACAAGG + Intergenic
1199118432 X:144020866-144020888 CAGTTATAAGAAAAGAAAAAAGG + Intergenic
1199323558 X:146470142-146470164 CAGTTCTAAAAAATGCAATAAGG - Intergenic
1199813850 X:151379087-151379109 CATTTCTAATAAATGGAATATGG + Intergenic