ID: 971761883

View in Genome Browser
Species Human (GRCh38)
Location 4:30776607-30776629
Sequence CTGAAGAAACGGTCTCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971761883_971761887 26 Left 971761883 4:30776607-30776629 CCTTCCTGAGACCGTTTCTTCAG 0: 1
1: 0
2: 1
3: 17
4: 231
Right 971761887 4:30776656-30776678 GAAAAAAATGTATCACGAGTTGG 0: 1
1: 0
2: 2
3: 15
4: 182
971761883_971761889 28 Left 971761883 4:30776607-30776629 CCTTCCTGAGACCGTTTCTTCAG 0: 1
1: 0
2: 1
3: 17
4: 231
Right 971761889 4:30776658-30776680 AAAAAATGTATCACGAGTTGGGG No data
971761883_971761888 27 Left 971761883 4:30776607-30776629 CCTTCCTGAGACCGTTTCTTCAG 0: 1
1: 0
2: 1
3: 17
4: 231
Right 971761888 4:30776657-30776679 AAAAAAATGTATCACGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971761883 Original CRISPR CTGAAGAAACGGTCTCAGGA AGG (reversed) Intronic
900750798 1:4396055-4396077 CTGACAAAACAGTCTCAGGGAGG + Intergenic
902405179 1:16178918-16178940 TTGAAGAAACAGGCTCAGGGAGG - Intergenic
904473590 1:30750748-30750770 ATGAGGAAACAGGCTCAGGAGGG - Intronic
905103511 1:35546312-35546334 GTGAGGAAACGGTCTCAAGAAGG + Intronic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
908112103 1:60908163-60908185 AAGAAGAAAGGGTCTCATGAAGG + Intronic
908918260 1:69158043-69158065 CAGAAGAAACAGCTTCAGGAAGG - Intergenic
912310664 1:108617796-108617818 ATGAAGAAACGGCCTCAGAAAGG + Intronic
913539462 1:119804975-119804997 GTGAGGAAACAGGCTCAGGATGG + Intronic
915006826 1:152645784-152645806 CTGAAGGACAGGTCCCAGGAAGG - Intergenic
916319271 1:163484613-163484635 CTGAAGTAGATGTCTCAGGAGGG + Intergenic
917044342 1:170841329-170841351 TTGAAGAAACGGACACTGGATGG + Intergenic
922951256 1:229559651-229559673 GTTAAGAAACGATCTCAGGCCGG - Intergenic
923666566 1:236003519-236003541 ATGAAGAAAGTGTTTCAGGAAGG + Intronic
1063129560 10:3166273-3166295 TTGAAGAAAGGGTCTCTGCACGG + Exonic
1063219077 10:3949876-3949898 CTGAAGATCTGGTTTCAGGAGGG - Intergenic
1063241450 10:4174172-4174194 CAGAGGAAAGTGTCTCAGGAAGG - Intergenic
1063620083 10:7638612-7638634 CTGAAGTAACTTTCTCAGAATGG - Intronic
1065331299 10:24603277-24603299 CAGAAGAAAGTGTTTCAGGAAGG + Intronic
1067781646 10:49211943-49211965 CAGAAGGAAGGGTCCCAGGATGG + Intergenic
1068610876 10:59058562-59058584 CTGAAGAATCAGTTTTAGGACGG + Intergenic
1069453527 10:68535994-68536016 ATGAAGACACCGTCACAGGATGG - Intergenic
1071954367 10:90741830-90741852 CTCAGGAACAGGTCTCAGGATGG - Exonic
1073591737 10:104764296-104764318 CTGATGAAGCGGTCTGAGGTGGG + Intronic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1075031210 10:119025810-119025832 CTGAAGAAACGTTCACAGACTGG + Intergenic
1075088483 10:119429815-119429837 CAGAAGACCCGGCCTCAGGAGGG - Intronic
1075115181 10:119620178-119620200 CTGAAGACAAAGTCTCAGGCAGG - Intergenic
1075122877 10:119676991-119677013 CAGGAGAGACGGTGTCAGGAAGG + Exonic
1075364192 10:121868931-121868953 AAGCAGAAATGGTCTCAGGAAGG + Intronic
1075730074 10:124630775-124630797 CTAAGGAAACTGTCACAGGAAGG - Intronic
1077944862 11:6885774-6885796 CTGAAGAAACTGTCCAAGGCTGG + Intergenic
1078955472 11:16189329-16189351 CTGAAGAAAGGGTTGCAAGAGGG + Intronic
1080640471 11:34155538-34155560 CTGAAGAAACGGCTCCAGCAAGG + Intronic
1081477010 11:43443501-43443523 CTGAAGAAAGGTCCCCAGGATGG + Exonic
1082997358 11:59264572-59264594 ATGAAGAAACAGGCTCAGGTGGG - Intergenic
1083203427 11:61133323-61133345 CTGAAGAAAATTTCTCTGGAAGG + Exonic
1085468198 11:76738339-76738361 CTGAAAAAGCAGTGTCAGGAAGG + Intergenic
1085520117 11:77132816-77132838 ATGATGAAACAGGCTCAGGAAGG + Intronic
1086836159 11:91625734-91625756 CTGAACAAACACTCTTAGGAGGG + Intergenic
1088392162 11:109326492-109326514 ATGAAGAAACAGTCCCAGAAAGG - Intergenic
1089192436 11:116662702-116662724 TTGAAGAAACAGTCTCAGAGAGG - Intergenic
1089217120 11:116841145-116841167 CAGAAGAAACGTTCTGAGCAGGG - Intergenic
1089604611 11:119634710-119634732 CTGAAAAGAAAGTCTCAGGATGG - Intronic
1090450317 11:126800424-126800446 CTACAGAAACGGTCTCATTAGGG + Intronic
1090587056 11:128224278-128224300 CAGAAGAAACTATCTCAGAATGG + Intergenic
1091132568 11:133158819-133158841 CTGAAGAACCCCTCTCAGGGAGG + Intronic
1091262687 11:134246446-134246468 CTGAAGAACCAATCCCAGGAAGG + Exonic
1092059754 12:5538761-5538783 ATGAAGAAAGTGTATCAGGAAGG + Intronic
1092895165 12:13003465-13003487 CTCAGGAACAGGTCTCAGGATGG + Intergenic
1093483635 12:19629778-19629800 ATGAAGAAACAATCTCAGGGAGG + Intronic
1094427073 12:30327169-30327191 CTGAAGAAAAGGTATGTGGAAGG - Intergenic
1094528566 12:31250395-31250417 GTCAAGAAACAGTCTCAGAAAGG - Intergenic
1095704995 12:45227477-45227499 CTGAAGAAACAGGCTCAGAGAGG - Intronic
1095980829 12:47973800-47973822 GTGAAGAAGCGGTCACAGGTTGG - Intronic
1097935263 12:65242230-65242252 CTGAAGAAAAAGTCTGAGGTAGG - Intronic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100012867 12:89974582-89974604 CTGTAAAAACAGTCTCAGGAAGG - Intergenic
1100201343 12:92300940-92300962 GTGAAGAAAGTGTCTCAAGAAGG + Intergenic
1101109080 12:101468191-101468213 ATGAAGAAACAGGCTCAGGGAGG - Intergenic
1101593355 12:106141414-106141436 TTGAAGAAACCGTATCAGAAAGG + Intergenic
1102195717 12:111023877-111023899 CTGAAGAAACAGGTTCAGGCAGG + Intergenic
1105311944 13:19219927-19219949 ATGAAGAAACGTGCTCAGAAAGG - Intergenic
1105363354 13:19741795-19741817 GTGAAGAAACGTGCTCAGAAAGG - Intronic
1107497743 13:40945074-40945096 CAGAAGAATCTGTCTCATGAAGG - Intronic
1107624345 13:42267705-42267727 CTGAAGAAACAGCCTGTGGAAGG + Intergenic
1107736549 13:43405141-43405163 CTGAAGAGACAGTTTCAGGCAGG + Intronic
1108025828 13:46176354-46176376 CTGAAAAAACATTTTCAGGATGG + Intronic
1108824037 13:54390162-54390184 CTTGAGGAACAGTCTCAGGAGGG + Intergenic
1109034681 13:57241355-57241377 CTGAAGAAACTGTTTCCAGATGG + Intergenic
1109313642 13:60724472-60724494 TGGAAGAAACAGCCTCAGGAGGG + Intergenic
1111949003 13:94694951-94694973 CTGAAGAAAGTGTTTCTGGAAGG + Intergenic
1115408644 14:33047821-33047843 CTGAGAAAACTGACTCAGGAAGG - Intronic
1116385953 14:44330088-44330110 CTGAAGAAACCACCACAGGAAGG - Intergenic
1116627772 14:47288013-47288035 CTGAAATTACGGTGTCAGGAGGG - Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119531141 14:75362184-75362206 CTGGAGACACACTCTCAGGAAGG - Intergenic
1119584925 14:75824391-75824413 TTGAAGAAAGGGTGTCAAGAAGG + Intronic
1120809279 14:88786512-88786534 CTTAAGAAAGGGTCTTAAGAAGG + Intronic
1121748061 14:96318341-96318363 CTGAAGAAACTGTCTCATAAAGG + Intronic
1121816451 14:96932639-96932661 ATGAAGACATGGTCTGAGGATGG + Intergenic
1121987305 14:98519972-98519994 CTGAAGTGAAGGTTTCAGGATGG + Intergenic
1122862147 14:104587503-104587525 GTGAAGAGACGGGGTCAGGAGGG + Intronic
1123585132 15:21753205-21753227 CTGGAGACACTGTCTCAGGAGGG - Intergenic
1123621779 15:22195812-22195834 CTGGAGACACTGTCTCAGGAGGG - Intergenic
1129230496 15:74194534-74194556 ATGGAGAAACGGTCTCAGAAAGG + Intronic
1130175942 15:81570919-81570941 CTGAAGAATGGGTTGCAGGAGGG - Intergenic
1130913985 15:88290626-88290648 CTGAAGAAACCTGCTCATGATGG - Intergenic
1132125314 15:99218514-99218536 CTGTAGAATCTGTCTCAGGTAGG - Intronic
1132153339 15:99477609-99477631 TTGAAGAAACAGGCTCAGGGAGG + Intergenic
1132775604 16:1592205-1592227 CTGAAGATGGGGTCTCACGAGGG - Exonic
1132860760 16:2070659-2070681 CTGCAGAGACGGCCCCAGGATGG + Intronic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1135574652 16:23576018-23576040 CTGAAGTGAGGGTCACAGGAGGG - Intergenic
1136014240 16:27384882-27384904 CGGGAGAAACTGCCTCAGGATGG - Intergenic
1136713510 16:32259033-32259055 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136754401 16:32670398-32670420 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1136813712 16:33199967-33199989 ATGAAAAAACAGTTTCAGGAAGG - Intronic
1136820188 16:33310047-33310069 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136826751 16:33366586-33366608 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136831817 16:33465357-33465379 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1137010436 16:35315447-35315469 GTGAGGAAACAGTCTCAGGGAGG + Intergenic
1137024048 16:35455773-35455795 ATGAGGAAACAGTCTCAGGGAGG + Intergenic
1137609401 16:49808919-49808941 CAGAAGACACGGCCTCAGAAAGG + Intronic
1137893561 16:52186959-52186981 CTGGAGAATCGGCTTCAGGATGG - Intergenic
1138421310 16:56901093-56901115 AAGAAGGAACGGTCTCAAGAAGG - Intronic
1138589032 16:57989632-57989654 ATGATGAAATGGACTCAGGAAGG + Intergenic
1138851286 16:60632858-60632880 CTGAAGCAAAGGGCTCAGGAAGG + Intergenic
1139193917 16:64896505-64896527 TTTAAGAAACAGTTTCAGGATGG + Intergenic
1142291309 16:89194754-89194776 CTCAAGGCACGGGCTCAGGAAGG - Intronic
1202992288 16_KI270728v1_random:22941-22963 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1203056548 16_KI270728v1_random:930729-930751 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1144265267 17:13562552-13562574 CTGAAGAAACAGTATCCTGATGG + Intronic
1144916163 17:18725435-18725457 CTGAACAAAAGGGCTCCGGAGGG + Intronic
1145960836 17:28885749-28885771 AGGAAGGCACGGTCTCAGGAGGG + Intronic
1146137174 17:30332954-30332976 CTATAGAAACGACCTCAGGAGGG - Intronic
1146206452 17:30909050-30909072 CTGAATAAATGCTTTCAGGAAGG - Intronic
1147636141 17:41965728-41965750 AAGAAGAAAGGGTTTCAGGAGGG + Intergenic
1148506620 17:48132466-48132488 CTGAGGAAATGCTCTGAGGAGGG - Intergenic
1148606020 17:48929385-48929407 CTAAAGGAAGGGTCTCAGTATGG + Exonic
1149848275 17:60020248-60020270 CTGTAGAAACTCACTCAGGAAGG + Intergenic
1149861894 17:60126276-60126298 CTGTAGAAACTCACTCAGGAAGG - Intergenic
1150086627 17:62276815-62276837 CTGTAGAAACTCACTCAGGAAGG + Intronic
1151040880 17:70859889-70859911 ATGAAGAAACAGTCTCAAGCAGG - Intergenic
1151337443 17:73448143-73448165 CTGAAGAAATGTTCTCAGCATGG + Intronic
1151916456 17:77121713-77121735 ATGAGGAAACGGGCTCAGAATGG + Intronic
1152771901 17:82175192-82175214 CTGGAGAAACAGTCGCATGAGGG + Intronic
1154052539 18:10974691-10974713 ATGAAGAAACGGGCTCTAGAGGG - Intronic
1154327986 18:13405949-13405971 TTAAAGAAACGGACTTAGGAAGG - Intronic
1158318257 18:56235857-56235879 ATGAAAAAAGGGTCTCAGGAAGG - Intergenic
1159478744 18:68959861-68959883 CTGAAGAGAGAGACTCAGGATGG - Intronic
1162034972 19:7933760-7933782 CTCAAGAAACGGACTCAGGAGGG + Intronic
1162375811 19:10304851-10304873 CTCAGGAGACGCTCTCAGGAAGG - Exonic
1163768395 19:19176336-19176358 CTGGAGAAATGGTCGCACGAAGG + Intronic
927866963 2:26595289-26595311 CTGCAGATACGGTCTCTGAAAGG + Exonic
928037822 2:27842033-27842055 CTGCAGAATTGTTCTCAGGATGG - Intronic
928309478 2:30197625-30197647 CTGGAGAAACTGGCTCAGGCAGG + Intergenic
929483664 2:42336454-42336476 CCGAAGAAAGGGCCTCAGGGAGG + Intronic
929561861 2:42961185-42961207 CTGAGAAAAGGGTTTCAGGAAGG - Intergenic
931381262 2:61755644-61755666 GTGAAGAAAGGGTCTCAGGCTGG - Intergenic
933280191 2:80324360-80324382 CTGAAGAAATGAGCTCAGCATGG - Intronic
933650544 2:84846796-84846818 CTGAAGAAACAGTCTCTGAGTGG + Intronic
935625221 2:105166814-105166836 CTGAATAAATGGCTTCAGGAAGG + Intergenic
935878138 2:107534657-107534679 CAGAAGAAAGTGTTTCAGGAAGG - Intergenic
939784997 2:146498457-146498479 CAGAAGAAAAGATTTCAGGAAGG + Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
945178120 2:207064262-207064284 CTGAAGAAACTGGCCCAGGGAGG + Intergenic
947367183 2:229408699-229408721 CTTAAGAATAGGGCTCAGGAAGG + Intronic
947935204 2:233998354-233998376 CTGAAGGAAGGGACTCAGAATGG + Intronic
949080866 2:242098380-242098402 CTAAAGAAAGGGTATCAGGAAGG - Intergenic
1168762586 20:359585-359607 GACAAGAAACGGTCTCAGGTTGG + Intronic
1169418096 20:5434500-5434522 CTGAAGAAAAGGACTCAGAGAGG + Intergenic
1172359015 20:34299370-34299392 GTAAAGAAAGGGTTTCAGGAAGG - Intronic
1173254318 20:41383167-41383189 GTGAAGAAACCGTATCAGGGTGG - Intergenic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1174984925 20:55440372-55440394 GTGAAGAAAGCGTTTCAGGAAGG + Intergenic
1175354879 20:58356651-58356673 CTGAAGAATTAGTATCAGGATGG - Intronic
1175878940 20:62245387-62245409 CTGAAGAACAGGTTTCAGGCCGG - Intronic
1178027549 21:28485392-28485414 TTGAAGAAACTTTCTCAGAAAGG + Intergenic
1181528540 22:23503020-23503042 CTGAAGAAATGTTCTTTGGATGG - Intergenic
1181783701 22:25210469-25210491 ATGAAGAAACAGGCTCAGGGAGG + Intergenic
1182219127 22:28743874-28743896 CTGAAGGAACGGTTGCTGGAAGG - Exonic
1182948766 22:34351203-34351225 CTGAAGAAAAGTTCTTAGGAGGG + Intergenic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
950708419 3:14798076-14798098 CTCAAGAAATGCTCTCAGCAGGG - Intergenic
953182637 3:40610941-40610963 CTGAAGAATGGGGCTCATGATGG - Intergenic
954352041 3:50052760-50052782 CGGAAGAAACAGTCTCAATATGG + Intronic
954759850 3:52866284-52866306 CTGAAGAGGCTGTCTCAGCACGG + Intronic
955362589 3:58288393-58288415 ATGCAGAAACCCTCTCAGGAAGG - Intronic
955424119 3:58769480-58769502 CTGAATGAATGCTCTCAGGAGGG + Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956112367 3:65882315-65882337 CTGAAGAAATCGCCTTAGGAAGG + Intronic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959714492 3:109417622-109417644 CTCAAGAAAGGGTCTCTGGGTGG + Intergenic
959736351 3:109663311-109663333 ATGAAAAAAAGGTCTCAGGCTGG - Intergenic
968008554 3:195258933-195258955 CTGAATCAACGGTATCAGCATGG + Intronic
969614480 4:8244400-8244422 CTGCAGAAACTGCCTCAGGCAGG + Intergenic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
971761883 4:30776607-30776629 CTGAAGAAACGGTCTCAGGAAGG - Intronic
979292411 4:118992290-118992312 CTGCTGAAACAGTCTGAGGAAGG + Intronic
980542170 4:134209148-134209170 TGGAAGAAAGGGTATCAGGATGG + Intergenic
985732167 5:1555458-1555480 CTTAAGCAACGTTGTCAGGAAGG - Intergenic
986199230 5:5566485-5566507 ATGAAGAAACGGCATCAGAAAGG + Intergenic
986315239 5:6582769-6582791 CCGACGAGACGGACTCAGGAGGG + Intergenic
990464235 5:56057165-56057187 CTGAAGAAATGAGCTCAGCAAGG + Intergenic
991127821 5:63087643-63087665 GTGAAGAAAAGGTCAAAGGATGG + Intergenic
991256120 5:64617262-64617284 CAGAAGAAACTGTATCTGGATGG - Intergenic
993821565 5:92623905-92623927 CTGAAGAAAGTGTTTCAAGAAGG + Intergenic
996505512 5:124263846-124263868 CTGAAGAAAGGTTCTCAAGCAGG + Intergenic
998059540 5:139109016-139109038 CAGAAGAAAAGTTCTAAGGAAGG - Intronic
999691199 5:154147340-154147362 ATGAAGAATTGGTCTCAGGTGGG - Intronic
1001657144 5:173360390-173360412 CTGAAGAATAGTACTCAGGAAGG + Intergenic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1006350060 6:33514357-33514379 GTGAAGGAAGGGTCTCAGGAGGG - Intergenic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1008051729 6:46906960-46906982 GTGAAGAAATGGTCACAGTAGGG + Intronic
1008098574 6:47366758-47366780 CAGAAGAAAGGGTCACAGGGAGG + Intergenic
1008883860 6:56410797-56410819 CTGAAGAAAGGATCACTGGAGGG - Intergenic
1009410476 6:63360418-63360440 TGGAAGAAAGGGTATCAGGATGG - Intergenic
1015879590 6:137857757-137857779 ATGAAGAAACGGCCTCAGTGAGG - Intergenic
1016932931 6:149427472-149427494 CTGCAGAAATGGTCACAGGTGGG + Intergenic
1017993529 6:159510588-159510610 GTGAGGAAATGGGCTCAGGAAGG - Intergenic
1018694999 6:166383606-166383628 CTGCAGCTACGGGCTCAGGAGGG + Intergenic
1018751444 6:166810073-166810095 CTGAAGACAAGGTGGCAGGATGG + Intronic
1022467346 7:30660733-30660755 CTGGAGATTGGGTCTCAGGAAGG - Intronic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1026653026 7:72232137-72232159 CAGAAGAAACTGCCTCAGCAGGG + Intronic
1027759546 7:82260662-82260684 CTGAAGAAATGGCCTTAGAAAGG + Intronic
1028426652 7:90696906-90696928 GTGAAGAAAGAGTTTCAGGAAGG + Intronic
1029221633 7:98995122-98995144 GTGAAGGAAGGGTCTCAGGAAGG - Intronic
1029281689 7:99439436-99439458 CAGAAGAGGAGGTCTCAGGATGG - Intronic
1029518445 7:101043542-101043564 CTGATGAAGGGGTCACAGGACGG - Exonic
1029966332 7:104744760-104744782 CTGAAGAGAGGGTTTCAAGATGG - Intronic
1030886074 7:114939058-114939080 CTGAAGAAATGCTCTGAAGAGGG - Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1031934272 7:127719949-127719971 CTTAAGAAACAATCTCAAGAAGG - Intronic
1034311814 7:150095089-150095111 CTGAAGAAGGGAGCTCAGGAAGG - Intergenic
1034795040 7:154005565-154005587 CTGAAGAAGGGAGCTCAGGAAGG + Intronic
1035606072 8:930485-930507 CTGCAGAAAAGGTCCGAGGAGGG + Intergenic
1038564788 8:28610677-28610699 ATGAAGAAATGGGCTCAGGTTGG + Intronic
1040039123 8:42897852-42897874 CTGAAGACCCGGCTTCAGGAAGG - Intronic
1040875018 8:52141900-52141922 AGGAAGAAAGGGTCCCAGGACGG + Intronic
1041531721 8:58875865-58875887 CTGAAGATACAGTCCCAGAATGG - Intronic
1042187617 8:66152633-66152655 CTGTAGAAAGAGACTCAGGAGGG - Intronic
1048928326 8:139290746-139290768 CTGGAGACACTGTCTCAGAAAGG + Intergenic
1049483890 8:142841350-142841372 GTGCAGAAACGCACTCAGGATGG - Intronic
1054740817 9:68804180-68804202 CAGGAGGAAGGGTCTCAGGAAGG + Intronic
1055553710 9:77454632-77454654 CTAAAGAAACAGTCTCAGAATGG - Intronic
1055700038 9:78934130-78934152 GAGAAGAAAAAGTCTCAGGAAGG + Intergenic
1056618587 9:88190948-88190970 GTGAAGAAACGCTTTGAGGATGG - Intergenic
1056805952 9:89729015-89729037 CTGAAGAAACCTTCAAAGGAGGG + Intergenic
1057529544 9:95831909-95831931 CTGAGAAAACAGCCTCAGGAAGG - Intergenic
1057978344 9:99630939-99630961 CTGAAAAAAGGGTACCAGGATGG - Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1059388918 9:113986656-113986678 CTGAAGAAAGGGTCTTTGGGAGG - Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1060010695 9:120040752-120040774 CTGAAGATATGCCCTCAGGATGG + Intergenic
1060015894 9:120086135-120086157 CTGAAGTTAGGGTCACAGGATGG + Intergenic
1060601199 9:124878996-124879018 CTGGAGAAGCGGCCTCTGGAAGG + Exonic
1061255579 9:129453134-129453156 CTGAAGAAATGTTCTTTGGATGG + Intergenic
1186986842 X:15026242-15026264 CTGAAGAGACATTTTCAGGAGGG + Intergenic
1188442463 X:30226146-30226168 CTGTAAAAACAGTCTCAGGCAGG + Intergenic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1191831282 X:65419114-65419136 CTGAAGAAATAATCACAGGATGG - Intronic
1195349116 X:103980181-103980203 ATGAAGAAACGGTCACAGCTGGG + Intergenic
1195358327 X:104058658-104058680 ATGAAGAAACGGTCACAGCTGGG - Intergenic
1195781016 X:108464183-108464205 ATGAAGAAAGGGGATCAGGAAGG - Intronic
1197735437 X:129847380-129847402 ATGAAGAAATAGTCTCAGAAAGG - Intergenic
1199588560 X:149442342-149442364 CTGAAATAACGGTGTCAGCAGGG - Intergenic